EMAIL THIS PAGE TO A FRIEND

CLCA2

chloride channel accessory 2

Synonyms: CACC CACC3 CLCRG2 CaCC-3
UniProtKB ID: Q9UQC9, A8K2T3, Q9Y6N2
Gene ID:
Human(9635) Summary: The protein encoded by this gene belongs to the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same site on chromosome 1p31-p22 and share high degrees of homology in size, sequence and predicted structure, but differ significantly in their tissue distributions. Since this protein is expressed predominantly in trachea and lung, it is suggested to play a role in the complex pathogenesis of cystic fibrosis. It may also serve as adhesion molecule for lung metastatic cancer cells, mediating vascular arrest and colonization, and furthermore, it has been implicated to act as a tumor suppressor gene for breast cancer. [provided by RefSeq, Jul 2008]
Mouse(80797) chloride channel calcium activated 2
Rat(362052) chloride channel calcium activated 2
chicken(771009) chloride channel, calcium activated, family member 2
Horse(100052615) chloride channel accessory 2
cow(534256) chloride channel accessory 2
domestic cat(101100988) chloride channel accessory 2
dog(612510) chloride channel accessory 2
domestic guinea pig(100728099) chloride channel accessory 2
naked mole-rat(101707664) chloride channel accessory 2
sheep(101115078) chloride channel accessory 2
Domestic Rabbit(100339003) chloride channel accessory 2
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006536 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006536 Rosetta Predictions human pricing
NM_001013202 Rosetta Predictions rat pricing
XM_001079170 Rosetta Predictions rat pricing
NM_030601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130571 predicted 2549
2 SASI_Hs01_00130572 predicted 268
3 SASI_Hs01_00130573 predicted 1269
4 SASI_Hs02_00341785 predicted 703
5 SASI_Hs01_00130575 predicted 1516
6 SASI_Hs02_00341786 predicted 1213
7 SASI_Hs01_00130576 predicted 1383
8 SASI_Hs01_00130578 predicted 1886
9 SASI_Hs02_00341787 predicted 1637
10 SASI_Hs01_00130579 predicted 2295
11 SASI_Hs01_00130574 predicted 2566
12 SASI_Hs01_00130577 predicted 328
13 SASI_Hs01_00130580 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059394 predicted 434
2 SASI_Rn01_00059395 predicted 535
3 SASI_Rn01_00059396 predicted 331
4 SASI_Rn02_00200977 predicted 532
5 SASI_Rn02_00200978 predicted 314
6 SASI_Rn02_00200979 predicted 2031
7 SASI_Rn01_00059400 predicted 2759
8 SASI_Rn01_00059401 predicted 2771
9 SASI_Rn01_00059402 predicted 1038
10 SASI_Rn02_00200980 predicted 2038
11 SASI_Rn01_00059397 predicted 423
12 SASI_Rn01_00059398 predicted 2460
13 SASI_Rn01_00059399 predicted 408
14 SASI_Rn01_00059403 predicted 2282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363349 predicted 415
2 SASI_Rn02_00363350 predicted 509
3 SASI_Rn02_00363351 predicted 311
4 SASI_Rn02_00363352 predicted 508
5 SASI_Rn02_00363353 predicted 1557
6 SASI_Rn02_00363354 predicted 301
7 SASI_Rn02_00363355 predicted 1478
8 SASI_Rn02_00363356 predicted 1984
9 SASI_Rn02_00363357 predicted 1018
10 SASI_Rn02_00363358 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078344 predicted 594
2 SASI_Mm01_00078345 predicted 2532
3 SASI_Mm01_00078346 predicted 2763
4 SASI_Mm01_00078347 predicted 563
5 SASI_Mm01_00078348 predicted 1859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006536
CLCA2 MISSION shRNA Bacterial Glycerol Stock
chloride channel accessory 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006536.5-1532s21c1
Sequence:CCGGCACGTCTTACAGGAGGTTTAACTCGAGTTAAACCTCCTGTAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006536.5-2304s21c1
Sequence:CCGGTTACACAGCAAACGGTAATATCTCGAGATATTACCGTTTGCTGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006536.5-528s21c1
Sequence:CCGGTGATCCATACACCCTACAATACTCGAGTATTGTAGGGTGTATGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006536.3-3120s1c1
Sequence:CCGGCCCTTACACTTTGGCTATGAACTCGAGTTCATAGCCAAAGTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-2492s1c1
Sequence:CCGGGCCAGGCTACAAGCTATGAAACTCGAGTTTCATAGCTTGTAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-584s1c1
Sequence:CCGGGCCGAGTGTTTGTCCATGAATCTCGAGATTCATGGACAAACACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-1984s1c1
Sequence:CCGGGCCAATGTGAAACAGGGATTTCTCGAGAAATCCCTGTTTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-955s1c1
Sequence:CCGGGCTGACTTTCACCACAGCTTTCTCGAGAAAGCTGTGGTGAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006536
CLCA2 MISSION shRNA shRNA Plasmid DNA
chloride channel accessory 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006536.5-1532s21c1
Sequence:CCGGCACGTCTTACAGGAGGTTTAACTCGAGTTAAACCTCCTGTAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006536.5-2304s21c1
Sequence:CCGGTTACACAGCAAACGGTAATATCTCGAGATATTACCGTTTGCTGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006536.5-528s21c1
Sequence:CCGGTGATCCATACACCCTACAATACTCGAGTATTGTAGGGTGTATGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006536.3-3120s1c1
Sequence:CCGGCCCTTACACTTTGGCTATGAACTCGAGTTCATAGCCAAAGTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-2492s1c1
Sequence:CCGGGCCAGGCTACAAGCTATGAAACTCGAGTTTCATAGCTTGTAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-584s1c1
Sequence:CCGGGCCGAGTGTTTGTCCATGAATCTCGAGATTCATGGACAAACACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-1984s1c1
Sequence:CCGGGCCAATGTGAAACAGGGATTTCTCGAGAAATCCCTGTTTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-955s1c1
Sequence:CCGGGCTGACTTTCACCACAGCTTTCTCGAGAAAGCTGTGGTGAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006536
CLCA2 MISSION shRNA Lentiviral Transduction Particles
chloride channel accessory 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006536.5-1532s21c1
Sequence:CCGGCACGTCTTACAGGAGGTTTAACTCGAGTTAAACCTCCTGTAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006536.5-2304s21c1
Sequence:CCGGTTACACAGCAAACGGTAATATCTCGAGATATTACCGTTTGCTGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006536.5-528s21c1
Sequence:CCGGTGATCCATACACCCTACAATACTCGAGTATTGTAGGGTGTATGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006536.3-3120s1c1
Sequence:CCGGCCCTTACACTTTGGCTATGAACTCGAGTTCATAGCCAAAGTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-2492s1c1
Sequence:CCGGGCCAGGCTACAAGCTATGAAACTCGAGTTTCATAGCTTGTAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-584s1c1
Sequence:CCGGGCCGAGTGTTTGTCCATGAATCTCGAGATTCATGGACAAACACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-1984s1c1
Sequence:CCGGGCCAATGTGAAACAGGGATTTCTCGAGAAATCCCTGTTTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006536.3-955s1c1
Sequence:CCGGGCTGACTTTCACCACAGCTTTCTCGAGAAAGCTGTGGTGAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030601
CLCA2 MISSION shRNA Bacterial Glycerol Stock
chloride channel accessory 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-583s1c1
Sequence:CCGGCGCCAGCATCACAGGCAAGAACTCGAGTTCTTGCCTGTGATGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-2615s1c1
Sequence:CCGGGCTGTCAAGTTTACTTCTCTACTCGAGTAGAGAAGTAAACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-1601s1c1
Sequence:CCGGCCAGAAATCATTCTTCAAGATCTCGAGATCTTGAAGAATGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-1916s1c1
Sequence:CCGGGCCATCATAGAAGCTGAACATCTCGAGATGTTCAGCTTCTATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-1408s1c1
Sequence:CCGGCAAACATGTAAGCAGCCTTATCTCGAGATAAGGCTGCTTACATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030601
CLCA2 MISSION shRNA shRNA Plasmid DNA
chloride channel accessory 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-583s1c1
Sequence:CCGGCGCCAGCATCACAGGCAAGAACTCGAGTTCTTGCCTGTGATGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-2615s1c1
Sequence:CCGGGCTGTCAAGTTTACTTCTCTACTCGAGTAGAGAAGTAAACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-1601s1c1
Sequence:CCGGCCAGAAATCATTCTTCAAGATCTCGAGATCTTGAAGAATGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-1916s1c1
Sequence:CCGGGCCATCATAGAAGCTGAACATCTCGAGATGTTCAGCTTCTATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-1408s1c1
Sequence:CCGGCAAACATGTAAGCAGCCTTATCTCGAGATAAGGCTGCTTACATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030601
CLCA2 MISSION shRNA Lentiviral Transduction Particles
chloride channel accessory 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-583s1c1
Sequence:CCGGCGCCAGCATCACAGGCAAGAACTCGAGTTCTTGCCTGTGATGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-2615s1c1
Sequence:CCGGGCTGTCAAGTTTACTTCTCTACTCGAGTAGAGAAGTAAACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-1601s1c1
Sequence:CCGGCCAGAAATCATTCTTCAAGATCTCGAGATCTTGAAGAATGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-1916s1c1
Sequence:CCGGGCCATCATAGAAGCTGAACATCTCGAGATGTTCAGCTTCTATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030601.2-1408s1c1
Sequence:CCGGCAAACATGTAAGCAGCCTTATCTCGAGATAAGGCTGCTTACATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks