EMAIL THIS PAGE TO A FRIEND

CLCA3P

chloride channel accessory 3, pseudogene

52 Gene Product Result for
Synonyms: CLCA3
Species: Human CLCA3P(9629)
UniProtKB ID: Q9Y6N3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004921 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004921 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221902 predicted 222
2 SASI_Hs01_00221903 predicted 324
3 SASI_Hs01_00221904 predicted 576
4 SASI_Hs01_00221905 predicted 648
5 SASI_Hs01_00221906 predicted 652
6 SASI_Hs01_00221907 predicted 300
7 SASI_Hs01_00221909 predicted 434
8 SASI_Hs01_00221910 predicted 1042
9 SASI_Hs01_00221911 predicted 500
10 SASI_Hs02_00338584 predicted 256
11 SASI_Hs01_00221908 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004921
CLCA3P MISSION shRNA Bacterial Glycerol Stock
chloride channel accessory 3, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-215s1c1
Sequence:CCGGCCACCAAACAAAGAGCTTATTCTCGAGAATAAGCTCTTTGTTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-715s1c1
Sequence:CCGGGCCAAGGAATCCATTGTGTTTCTCGAGAAACACAATGGATTCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-80s1c1
Sequence:CCGGGCTCACTGGTAACTTTGAATACTCGAGTATTCAAAGTTACCAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-582s1c1
Sequence:CCGGCACTCGTATTACTGTTTACATCTCGAGATGTAAACAGTAATACGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-421s1c1
Sequence:CCGGCCAAACTTCTTGTTGACTAATCTCGAGATTAGTCAACAAGAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004921
CLCA3P MISSION shRNA shRNA Plasmid DNA
chloride channel accessory 3, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-215s1c1
Sequence:CCGGCCACCAAACAAAGAGCTTATTCTCGAGAATAAGCTCTTTGTTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-715s1c1
Sequence:CCGGGCCAAGGAATCCATTGTGTTTCTCGAGAAACACAATGGATTCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-80s1c1
Sequence:CCGGGCTCACTGGTAACTTTGAATACTCGAGTATTCAAAGTTACCAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-582s1c1
Sequence:CCGGCACTCGTATTACTGTTTACATCTCGAGATGTAAACAGTAATACGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-421s1c1
Sequence:CCGGCCAAACTTCTTGTTGACTAATCTCGAGATTAGTCAACAAGAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004921
CLCA3P MISSION shRNA Lentiviral Transduction Particles
chloride channel accessory 3, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-215s1c1
Sequence:CCGGCCACCAAACAAAGAGCTTATTCTCGAGAATAAGCTCTTTGTTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-715s1c1
Sequence:CCGGGCCAAGGAATCCATTGTGTTTCTCGAGAAACACAATGGATTCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-80s1c1
Sequence:CCGGGCTCACTGGTAACTTTGAATACTCGAGTATTCAAAGTTACCAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-582s1c1
Sequence:CCGGCACTCGTATTACTGTTTACATCTCGAGATGTAAACAGTAATACGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004921.1-421s1c1
Sequence:CCGGCCAAACTTCTTGTTGACTAATCTCGAGATTAGTCAACAAGAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)