EMAIL THIS PAGE TO A FRIEND

CLCA4

chloride channel accessory 4

53 Gene Product Result for
Synonyms: CaCC CaCC2
UniProtKB ID: Q14CN2, Q6UX81, Q9UNF7
Gene ID:
Human(22802) Summary: The protein encoded by this gene belongs to the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same site on chromosome 1p31-p22 and share high degrees of homology in size, sequence and predicted structure, but differ significantly in their tissue distributions. Alternative splicing results in multiple transcript variants, only one of which is thought to be protein coding. [provided by RefSeq, Dec 2008]
Mouse(229927) chloride channel calcium activated 4
Rat(362053) chloride channel accessory 4
dog(612508) chloride channel accessory 4
Horse(100063509) chloride channel accessory 4
cow(507504) chloride channel accessory 4
Horse(100063474) chloride channel accessory 4
domestic cat(101092951) chloride channel accessory 4
sheep(101115586) chloride channel accessory 4
Domestic Rabbit(100353613) chloride channel accessory 4
naked mole-rat(101707297) chloride channel accessory 4
domestic guinea pig(100727821) chloride channel accessory 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040231 MISSION® esiRNA esiRNA human CLCA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012128 Rosetta Predictions human pricing
NM_201419 Rosetta Predictions rat pricing
NM_139148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343676 predicted 1540
2 SASI_Hs01_00207365 predicted 2117
3 SASI_Hs01_00207366 predicted 2015
4 SASI_Hs01_00207367 predicted 962
5 SASI_Hs01_00207368 predicted 1233
6 SASI_Hs01_00207369 predicted 1094
7 SASI_Hs01_00207370 predicted 1811
8 SASI_Hs01_00207371 predicted 2424
9 SASI_Hs01_00207372 predicted 2291
10 SASI_Hs01_00207373 predicted 2131
11 SASI_Hs01_00207364 predicted 2739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063530 predicted 738
2 SASI_Rn01_00063531 predicted 1017
3 SASI_Rn01_00063532 predicted 928
4 SASI_Rn01_00063535 predicted 1613
5 SASI_Rn01_00063537 predicted 1284
6 SASI_Rn01_00063538 predicted 726
7 SASI_Rn01_00063539 predicted 2820
8 SASI_Rn02_00270313 predicted 2007
9 SASI_Rn02_00270314 predicted 1495
10 SASI_Rn02_00270315 predicted 2137
11 SASI_Rn01_00063533 predicted 1923
12 SASI_Rn01_00063534 predicted 2023
13 SASI_Rn01_00063536 predicted 2282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038605 predicted 1090
2 SASI_Mm01_00038606 predicted 1143
3 SASI_Mm02_00339897 predicted 2626
4 SASI_Mm01_00038607 predicted 1727
5 SASI_Mm01_00038608 predicted 1001
6 SASI_Mm01_00038609 predicted 1754
7 SASI_Mm01_00038610 predicted 2131
8 SASI_Mm01_00038611 predicted 1579
9 SASI_Mm01_00038612 predicted 2088
10 SASI_Mm01_00038613 predicted 2005
11 SASI_Mm01_00038614 predicted 2467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012128
CLCA4 MISSION shRNA Bacterial Glycerol Stock
chloride channel accessory 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-949s1c1
Sequence:CCGGCGTCAAAGAATTGTGTGCTTACTCGAGTAAGCACACAATTCTTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-671s1c1
Sequence:CCGGGCAGAATTGATTCTACAACAACTCGAGTTGTTGTAGAATCAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-90s1c1
Sequence:CCGGGCACCAGTCAAATACTTCCTTCTCGAGAAGGAAGTATTTGACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-1099s1c1
Sequence:CCGGGCCACTATTGTAAATAAGCTACTCGAGTAGCTTATTTACAATAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-1885s1c1
Sequence:CCGGGCAGAAATTCTACAAGGATATCTCGAGATATCCTTGTAGAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012128.3-413s21c1
Sequence:CCGGATGTGGAGAGAAAGGCGAATACTCGAGTATTCGCCTTTCTCTCCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012128.3-1551s21c1
Sequence:CCGGATGAACGACACTGTCATAATTCTCGAGAATTATGACAGTGTCGTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012128
CLCA4 MISSION shRNA shRNA Plasmid DNA
chloride channel accessory 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-949s1c1
Sequence:CCGGCGTCAAAGAATTGTGTGCTTACTCGAGTAAGCACACAATTCTTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-671s1c1
Sequence:CCGGGCAGAATTGATTCTACAACAACTCGAGTTGTTGTAGAATCAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-90s1c1
Sequence:CCGGGCACCAGTCAAATACTTCCTTCTCGAGAAGGAAGTATTTGACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-1099s1c1
Sequence:CCGGGCCACTATTGTAAATAAGCTACTCGAGTAGCTTATTTACAATAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-1885s1c1
Sequence:CCGGGCAGAAATTCTACAAGGATATCTCGAGATATCCTTGTAGAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012128.3-413s21c1
Sequence:CCGGATGTGGAGAGAAAGGCGAATACTCGAGTATTCGCCTTTCTCTCCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012128.3-1551s21c1
Sequence:CCGGATGAACGACACTGTCATAATTCTCGAGAATTATGACAGTGTCGTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012128
CLCA4 MISSION shRNA Lentiviral Transduction Particles
chloride channel accessory 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-949s1c1
Sequence:CCGGCGTCAAAGAATTGTGTGCTTACTCGAGTAAGCACACAATTCTTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-671s1c1
Sequence:CCGGGCAGAATTGATTCTACAACAACTCGAGTTGTTGTAGAATCAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-90s1c1
Sequence:CCGGGCACCAGTCAAATACTTCCTTCTCGAGAAGGAAGTATTTGACTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-1099s1c1
Sequence:CCGGGCCACTATTGTAAATAAGCTACTCGAGTAGCTTATTTACAATAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012128.2-1885s1c1
Sequence:CCGGGCAGAAATTCTACAAGGATATCTCGAGATATCCTTGTAGAATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012128.3-413s21c1
Sequence:CCGGATGTGGAGAGAAAGGCGAATACTCGAGTATTCGCCTTTCTCTCCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012128.3-1551s21c1
Sequence:CCGGATGAACGACACTGTCATAATTCTCGAGAATTATGACAGTGTCGTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139148
VALIDATED
CLCA4 MISSION shRNA Bacterial Glycerol Stock
chloride channel accessory 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139148.1-1020s1c1
Sequence:CCGGGCAGAGCTATACTTAATTCAACTCGAGTTGAATTAAGTATAGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139148.1-2082s1c1
Sequence:CCGGGCAAGAAAGAACATGGCTAAACTCGAGTTTAGCCATGTTCTTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139148.1-2628s1c1
Sequence:CCGGGTGAAGTTTATTCCTCCACAACTCGAGTTGTGGAGGAATAAACTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139148.1-1090s1c1
Sequence:CCGGCCACAATCCAAACTAACCTAACTCGAGTTAGGTTAGTTTGGATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139148.1-1661s1c1
Sequence:CCGGCCAGGAAGATAAGCTAAATATCTCGAGATATTTAGCTTATCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139148
VALIDATED
CLCA4 MISSION shRNA shRNA Plasmid DNA
chloride channel accessory 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139148.1-1020s1c1
Sequence:CCGGGCAGAGCTATACTTAATTCAACTCGAGTTGAATTAAGTATAGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139148.1-2082s1c1
Sequence:CCGGGCAAGAAAGAACATGGCTAAACTCGAGTTTAGCCATGTTCTTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139148.1-2628s1c1
Sequence:CCGGGTGAAGTTTATTCCTCCACAACTCGAGTTGTGGAGGAATAAACTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139148.1-1090s1c1
Sequence:CCGGCCACAATCCAAACTAACCTAACTCGAGTTAGGTTAGTTTGGATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139148.1-1661s1c1
Sequence:CCGGCCAGGAAGATAAGCTAAATATCTCGAGATATTTAGCTTATCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139148
VALIDATED
CLCA4 MISSION shRNA Lentiviral Transduction Particles
chloride channel accessory 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139148.1-1020s1c1
Sequence:CCGGGCAGAGCTATACTTAATTCAACTCGAGTTGAATTAAGTATAGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139148.1-2082s1c1
Sequence:CCGGGCAAGAAAGAACATGGCTAAACTCGAGTTTAGCCATGTTCTTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139148.1-2628s1c1
Sequence:CCGGGTGAAGTTTATTCCTCCACAACTCGAGTTGTGGAGGAATAAACTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139148.1-1090s1c1
Sequence:CCGGCCACAATCCAAACTAACCTAACTCGAGTTAGGTTAGTTTGGATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139148.1-1661s1c1
Sequence:CCGGCCAGGAAGATAAGCTAAATATCTCGAGATATTTAGCTTATCTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)