EMAIL THIS PAGE TO A FRIEND

CLCC1

chloride channel CLIC-like 1

62 Gene Product Result for
Synonyms: MCLC
UniProtKB ID: Q96S66, O94861, Q8WYP8, Q8WYP9, Q9BU25
Gene ID:
Mouse(229725) chloride channel CLIC-like 1
Rat(170927) chloride channel CLIC-like 1
sheep(101122902) chloride channel CLIC-like 1
Domestic Rabbit(100341537) chloride channel CLIC-like 1
domestic guinea pig(100727735) chloride channel CLIC-like 1
naked mole-rat(101722225) chloride channel CLIC-like 1
chicken(424343) chloride channel CLIC-like 1
cow(519085) chloride channel CLIC-like 1
Horse(100061004) chloride channel CLIC-like 1
domestic cat(101088680) chloride channel CLIC-like 1
dog(479918) chloride channel CLIC-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015127 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048210 Rosetta Predictions human pricing
NM_015127 Rosetta Predictions human pricing
NM_133414 Rosetta Predictions rat pricing
NM_145543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311702 predicted 1133
2 SASI_Hs02_00311703 predicted 862
3 SASI_Hs02_00311704 predicted 1700
4 SASI_Hs02_00311705 predicted 1152
5 SASI_Hs02_00311706 predicted 911
6 SASI_Hs02_00311707 predicted 1649
7 SASI_Hs02_00311708 predicted 942
8 SASI_Hs02_00311709 predicted 1056
9 SASI_Hs02_00311710 predicted 1787
10 SASI_Hs02_00311711 predicted 1617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347037 predicted 993
2 SASI_Hs01_00069182 predicted 717
3 SASI_Hs02_00347038 predicted 1557
4 SASI_Hs01_00069184 predicted 1010
5 SASI_Hs01_00069185 predicted 767
6 SASI_Hs02_00347039 predicted 1503
7 SASI_Hs01_00069187 predicted 804
8 SASI_Hs01_00069188 predicted 914
9 SASI_Hs02_00347040 predicted 1641
10 SASI_Hs02_00347041 predicted 1486
11 SASI_Hs01_00069183 predicted 370
12 SASI_Hs01_00069186 predicted 509
13 SASI_Hs01_00069189 predicted 1644
14 SASI_Hs01_00069190 predicted 701
15 SASI_Hs01_00069191 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036963 predicted 956
2 SASI_Rn01_00036964 predicted 1455
3 SASI_Rn01_00036965 predicted 676
4 SASI_Rn02_00267670 predicted 1173
5 SASI_Rn01_00036966 predicted 1317
6 SASI_Rn01_00036967 predicted 1423
7 SASI_Rn01_00036968 predicted 865
8 SASI_Rn01_00036969 predicted 951
9 SASI_Rn01_00036970 predicted 1363
10 SASI_Rn01_00036971 predicted 548
11 SASI_Rn01_00036972 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056797 predicted 1812
2 SASI_Mm01_00056798 predicted 924
3 SASI_Mm01_00056799 predicted 196
4 SASI_Mm01_00056800 predicted 1470
5 SASI_Mm01_00056801 predicted 791
6 SASI_Mm01_00056802 predicted 368
7 SASI_Mm01_00056803 predicted 1404
8 SASI_Mm01_00056804 predicted 852
9 SASI_Mm01_00056805 predicted 1801
10 SASI_Mm02_00341029 predicted 449
11 SASI_Mm01_00056806 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015127
VALIDATED
CLCC1 MISSION shRNA Bacterial Glycerol Stock
chloride channel CLIC-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015127.2-810s1c1
Sequence:CCGGGCTCTTACTAGTCAACCCTATCTCGAGATAGGGTTGACTAGTAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015127.3-522s21c1
Sequence:CCGGTTTGGAGTGGATCCATATAATCTCGAGATTATATGGATCCACTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015127.3-916s21c1
Sequence:CCGGCGGAGCCATTGAAGCATATTGCTCGAGCAATATGCTTCAATGGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015127.3-2407s21c1
Sequence:CCGGACGTTGTGGTTTGGTATATTGCTCGAGCAATATACCAAACCACAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015127.3-1060s21c1
Sequence:CCGGTTCATGTGCTGAGACATATAGCTCGAGCTATATGTCTCAGCACATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015127
VALIDATED
CLCC1 MISSION shRNA shRNA Plasmid DNA
chloride channel CLIC-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015127.2-810s1c1
Sequence:CCGGGCTCTTACTAGTCAACCCTATCTCGAGATAGGGTTGACTAGTAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015127.3-522s21c1
Sequence:CCGGTTTGGAGTGGATCCATATAATCTCGAGATTATATGGATCCACTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015127.3-916s21c1
Sequence:CCGGCGGAGCCATTGAAGCATATTGCTCGAGCAATATGCTTCAATGGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015127.3-2407s21c1
Sequence:CCGGACGTTGTGGTTTGGTATATTGCTCGAGCAATATACCAAACCACAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015127.3-1060s21c1
Sequence:CCGGTTCATGTGCTGAGACATATAGCTCGAGCTATATGTCTCAGCACATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015127
VALIDATED
CLCC1 MISSION shRNA Lentiviral Transduction Particles
chloride channel CLIC-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015127.2-810s1c1
Sequence:CCGGGCTCTTACTAGTCAACCCTATCTCGAGATAGGGTTGACTAGTAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015127.3-522s21c1
Sequence:CCGGTTTGGAGTGGATCCATATAATCTCGAGATTATATGGATCCACTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015127.3-916s21c1
Sequence:CCGGCGGAGCCATTGAAGCATATTGCTCGAGCAATATGCTTCAATGGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015127.3-2407s21c1
Sequence:CCGGACGTTGTGGTTTGGTATATTGCTCGAGCAATATACCAAACCACAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015127.3-1060s21c1
Sequence:CCGGTTCATGTGCTGAGACATATAGCTCGAGCTATATGTCTCAGCACATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145543
VALIDATED
CLCC1 MISSION shRNA Bacterial Glycerol Stock
chloride channel CLIC-like 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145543.1-733s1c1
Sequence:CCGGCGCTGGTACACACAGATGAAACTCGAGTTTCATCTGTGTGTACCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145543.1-1012s1c1
Sequence:CCGGGCGATTACATTCACTAACTTTCTCGAGAAAGTTAGTGAATGTAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145543.1-861s1c1
Sequence:CCGGCGACAATTTATGTGCTAAGAACTCGAGTTCTTAGCACATAAATTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194132    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145543.1-1957s1c1
Sequence:CCGGGCTGATACTATCAGGCGTTTACTCGAGTAAACGCCTGATAGTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145543.1-963s1c1
Sequence:CCGGGCTCCTAATAGTCAACCCTATCTCGAGATAGGGTTGACTATTAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145543.1-325s1c1
Sequence:CCGGGATTCTTTAACTCACAAGGTTCTCGAGAACCTTGTGAGTTAAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145543.1-857s1c1
Sequence:CCGGCTTTCGACAATTTATGTGCTACTCGAGTAGCACATAAATTGTCGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145543.1-2628s1c1
Sequence:CCGGGCTCAAGAATTAAGTCTTGAACTCGAGTTCAAGACTTAATTCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145543.1-850s21c1
Sequence:CCGGATGGAGCCTTTCGACAATTTACTCGAGTAAATTGTCGAAAGGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145543.1-784s21c1
Sequence:CCGGTTAGCATGGAATTGGATATATCTCGAGATATATCCAATTCCATGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145543.1-1029s21c1
Sequence:CCGGCTTTGTAACGGAACCATTAAACTCGAGTTTAATGGTTCCGTTACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145543.1-1958s21c1
Sequence:CCGGCTGATACTATCAGGCGTTTAACTCGAGTTAAACGCCTGATAGTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145543.1-643s21c1
Sequence:CCGGTTTGGAGTAGATCCATATAATCTCGAGATTATATGGATCTACTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145543
VALIDATED
CLCC1 MISSION shRNA shRNA Plasmid DNA
chloride channel CLIC-like 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145543.1-733s1c1
Sequence:CCGGCGCTGGTACACACAGATGAAACTCGAGTTTCATCTGTGTGTACCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145543.1-1012s1c1
Sequence:CCGGGCGATTACATTCACTAACTTTCTCGAGAAAGTTAGTGAATGTAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145543.1-861s1c1
Sequence:CCGGCGACAATTTATGTGCTAAGAACTCGAGTTCTTAGCACATAAATTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194132    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145543.1-1957s1c1
Sequence:CCGGGCTGATACTATCAGGCGTTTACTCGAGTAAACGCCTGATAGTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145543.1-963s1c1
Sequence:CCGGGCTCCTAATAGTCAACCCTATCTCGAGATAGGGTTGACTATTAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145543.1-325s1c1
Sequence:CCGGGATTCTTTAACTCACAAGGTTCTCGAGAACCTTGTGAGTTAAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145543.1-857s1c1
Sequence:CCGGCTTTCGACAATTTATGTGCTACTCGAGTAGCACATAAATTGTCGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145543.1-2628s1c1
Sequence:CCGGGCTCAAGAATTAAGTCTTGAACTCGAGTTCAAGACTTAATTCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145543.1-850s21c1
Sequence:CCGGATGGAGCCTTTCGACAATTTACTCGAGTAAATTGTCGAAAGGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145543.1-784s21c1
Sequence:CCGGTTAGCATGGAATTGGATATATCTCGAGATATATCCAATTCCATGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145543.1-1029s21c1
Sequence:CCGGCTTTGTAACGGAACCATTAAACTCGAGTTTAATGGTTCCGTTACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145543.1-1958s21c1
Sequence:CCGGCTGATACTATCAGGCGTTTAACTCGAGTTAAACGCCTGATAGTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145543.1-643s21c1
Sequence:CCGGTTTGGAGTAGATCCATATAATCTCGAGATTATATGGATCTACTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145543
VALIDATED
CLCC1 MISSION shRNA Lentiviral Transduction Particles
chloride channel CLIC-like 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145543.1-733s1c1
Sequence:CCGGCGCTGGTACACACAGATGAAACTCGAGTTTCATCTGTGTGTACCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145543.1-1012s1c1
Sequence:CCGGGCGATTACATTCACTAACTTTCTCGAGAAAGTTAGTGAATGTAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145543.1-861s1c1
Sequence:CCGGCGACAATTTATGTGCTAAGAACTCGAGTTCTTAGCACATAAATTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194132    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145543.1-1957s1c1
Sequence:CCGGGCTGATACTATCAGGCGTTTACTCGAGTAAACGCCTGATAGTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145543.1-963s1c1
Sequence:CCGGGCTCCTAATAGTCAACCCTATCTCGAGATAGGGTTGACTATTAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145543.1-325s1c1
Sequence:CCGGGATTCTTTAACTCACAAGGTTCTCGAGAACCTTGTGAGTTAAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145543.1-857s1c1
Sequence:CCGGCTTTCGACAATTTATGTGCTACTCGAGTAGCACATAAATTGTCGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145543.1-2628s1c1
Sequence:CCGGGCTCAAGAATTAAGTCTTGAACTCGAGTTCAAGACTTAATTCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145543.1-850s21c1
Sequence:CCGGATGGAGCCTTTCGACAATTTACTCGAGTAAATTGTCGAAAGGCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145543.1-784s21c1
Sequence:CCGGTTAGCATGGAATTGGATATATCTCGAGATATATCCAATTCCATGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145543.1-1029s21c1
Sequence:CCGGCTTTGTAACGGAACCATTAAACTCGAGTTTAATGGTTCCGTTACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145543.1-1958s21c1
Sequence:CCGGCTGATACTATCAGGCGTTTAACTCGAGTTAAACGCCTGATAGTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145543.1-643s21c1
Sequence:CCGGTTTGGAGTAGATCCATATAATCTCGAGATTATATGGATCTACTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)