EMAIL THIS PAGE TO A FRIEND

CLCF1

cardiotrophin-like cytokine factor 1

128 Gene Product Result for
Synonyms: BSF-3 BSF3 CISS2 CLC NNT-1 NNT1 NR6
UniProtKB ID: Q9UBD9, B4DNT4, Q6NZA4
Gene ID:
Human(23529) Summary: This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Mouse(56708) cardiotrophin-like cytokine factor 1
Rat(365395) cardiotrophin-like cytokine factor 1
chicken(100858060) cardiotrophin-like cytokine factor 1
domestic cat(101101338) cardiotrophin-like cytokine factor 1
cow(100336481) cardiotrophin-like cytokine factor 1
dog(483697) cardiotrophin-like cytokine factor 1
naked mole-rat(101706033) cardiotrophin-like cytokine factor 1
domestic guinea pig(100721145) cardiotrophin-like cytokine factor 1
sheep(101108788) cardiotrophin-like cytokine factor 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013246 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013246 Rosetta Predictions human pricing
NM_207615 Rosetta Predictions rat pricing
NM_019952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167879 predicted 468
2 SASI_Hs01_00167880 predicted 1121
3 SASI_Hs01_00167881 predicted 505
4 SASI_Hs01_00167882 predicted 394
5 SASI_Hs01_00167883 predicted 1345
6 SASI_Hs01_00167884 predicted 322
7 SASI_Hs01_00167885 predicted 1333
8 SASI_Hs01_00167886 predicted 795
9 SASI_Hs02_00344454 predicted 1158
10 SASI_Hs02_00344455 predicted 696
11 SASI_Hs01_00167878 predicted 720
12 SASI_Hs01_00167887 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102776 predicted 397
2 SASI_Rn01_00102777 predicted 1217
3 SASI_Rn01_00102778 predicted 368
4 SASI_Rn01_00102779 predicted 449
5 SASI_Rn01_00102780 predicted 870
6 SASI_Rn01_00102781 predicted 684
7 SASI_Rn01_00102782 predicted 842
8 SASI_Rn01_00102783 predicted 1366
9 SASI_Rn01_00102784 predicted 228
10 SASI_Rn01_00102785 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022200 predicted 478
2 SASI_Mm01_00022201 predicted 244
3 SASI_Mm01_00022202 predicted 251
4 SASI_Mm01_00022204 predicted 292
5 SASI_Mm01_00022205 predicted 395
6 SASI_Mm01_00022206 predicted 365
7 SASI_Mm01_00022207 predicted 529
8 SASI_Mm01_00022208 predicted 418
9 SASI_Mm01_00022209 predicted 427
10 SASI_Mm02_00325248 predicted 412
11 SASI_Mm01_00022203 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019952
VALIDATED
CLCF1 MISSION shRNA Bacterial Glycerol Stock
cardiotrophin-like cytokine factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-467s21c1
Sequence:CCGGCCACAGCTGAACTCCGACGTACTCGAGTACGTCGGAGTTCAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-404s21c1
Sequence:CCGGCCCAGAACTATGAGGCGTACACTCGAGTGTACGCCTCATAGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-123s21c1
Sequence:CCGGGATGTTAGCTTGCCTATGCACCTCGAGGTGCATAGGCAAGCTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-436s21c1
Sequence:CCGGTGTTACTTGCGTGGCCTCAACCTCGAGGTTGAGGCCACGCAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-244s21c1
Sequence:CCGGGAGCATCAACTCCGCAGCTTACTCGAGTAAGCTGCGGAGTTGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-173s1c1
Sequence:CCGGGCTCTTAATCGCACAGGAGATCTCGAGATCTCCTGTGCGATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019952.1-468s1c1
Sequence:CCGGCCACAGCTGAACTCCGACGTACTCGAGTACGTCGGAGTTCAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-295s1c1
Sequence:CCGGCCCTTTCAACGAGCCTGACTTCTCGAGAAGTCAGGCTCGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-628s1c1
Sequence:CCGGCCTCCAGAAGATGGATGACTTCTCGAGAAGTCATCCATCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-360s1c1
Sequence:CCGGTCAACTTGGAAGTGTGGCGAACTCGAGTTCGCCACACTTCCAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019952
VALIDATED
CLCF1 MISSION shRNA shRNA Plasmid DNA
cardiotrophin-like cytokine factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-467s21c1
Sequence:CCGGCCACAGCTGAACTCCGACGTACTCGAGTACGTCGGAGTTCAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-404s21c1
Sequence:CCGGCCCAGAACTATGAGGCGTACACTCGAGTGTACGCCTCATAGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-123s21c1
Sequence:CCGGGATGTTAGCTTGCCTATGCACCTCGAGGTGCATAGGCAAGCTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-436s21c1
Sequence:CCGGTGTTACTTGCGTGGCCTCAACCTCGAGGTTGAGGCCACGCAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-244s21c1
Sequence:CCGGGAGCATCAACTCCGCAGCTTACTCGAGTAAGCTGCGGAGTTGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-173s1c1
Sequence:CCGGGCTCTTAATCGCACAGGAGATCTCGAGATCTCCTGTGCGATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019952.1-468s1c1
Sequence:CCGGCCACAGCTGAACTCCGACGTACTCGAGTACGTCGGAGTTCAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-295s1c1
Sequence:CCGGCCCTTTCAACGAGCCTGACTTCTCGAGAAGTCAGGCTCGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-628s1c1
Sequence:CCGGCCTCCAGAAGATGGATGACTTCTCGAGAAGTCATCCATCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-360s1c1
Sequence:CCGGTCAACTTGGAAGTGTGGCGAACTCGAGTTCGCCACACTTCCAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019952
VALIDATED
CLCF1 MISSION shRNA Lentiviral Transduction Particles
cardiotrophin-like cytokine factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-467s21c1
Sequence:CCGGCCACAGCTGAACTCCGACGTACTCGAGTACGTCGGAGTTCAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-404s21c1
Sequence:CCGGCCCAGAACTATGAGGCGTACACTCGAGTGTACGCCTCATAGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-123s21c1
Sequence:CCGGGATGTTAGCTTGCCTATGCACCTCGAGGTGCATAGGCAAGCTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-436s21c1
Sequence:CCGGTGTTACTTGCGTGGCCTCAACCTCGAGGTTGAGGCCACGCAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019952.3-244s21c1
Sequence:CCGGGAGCATCAACTCCGCAGCTTACTCGAGTAAGCTGCGGAGTTGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-173s1c1
Sequence:CCGGGCTCTTAATCGCACAGGAGATCTCGAGATCTCCTGTGCGATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019952.1-468s1c1
Sequence:CCGGCCACAGCTGAACTCCGACGTACTCGAGTACGTCGGAGTTCAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-295s1c1
Sequence:CCGGCCCTTTCAACGAGCCTGACTTCTCGAGAAGTCAGGCTCGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-628s1c1
Sequence:CCGGCCTCCAGAAGATGGATGACTTCTCGAGAAGTCATCCATCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019952.1-360s1c1
Sequence:CCGGTCAACTTGGAAGTGTGGCGAACTCGAGTTCGCCACACTTCCAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013246
CLCF1 MISSION shRNA Bacterial Glycerol Stock
cardiotrophin-like cytokine factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1346s1c1
Sequence:CCGGGAAACAAACATGGTGGCAATTCTCGAGAATTGCCACCATGTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013246.2-1648s1c1
Sequence:CCGGCCTGAAAGTTTACAATGCAGTCTCGAGACTGCATTGTAAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1541s1c1
Sequence:CCGGCCTCGAATTGTCTTCCAGTATCTCGAGATACTGGAAGACAATTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013246.2-802s1c1
Sequence:CCGGCAACCGGCTCAAGAAGAAGATCTCGAGATCTTCTTCTTGAGCCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013246.2-809s1c1
Sequence:CCGGCTCAAGAAGAAGATGCAGCCTCTCGAGAGGCTGCATCTTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013246.2-478s1c1
Sequence:CCGGGCGAAGCCTCAATGACAAACTCTCGAGAGTTTGTCATTGAGGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1354s1c1
Sequence:CCGGCATGGTGGCAATTCTACACAACTCGAGTTGTGTAGAATTGCCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1092s1c1
Sequence:CCGGCCTGTTTCTACAGGAAGTCATCTCGAGATGACTTCCTGTAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1637s1c1
Sequence:CCGGCCACAGGATTTCCTGAAAGTTCTCGAGAACTTTCAGGAAATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013246
CLCF1 MISSION shRNA shRNA Plasmid DNA
cardiotrophin-like cytokine factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1346s1c1
Sequence:CCGGGAAACAAACATGGTGGCAATTCTCGAGAATTGCCACCATGTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013246.2-1648s1c1
Sequence:CCGGCCTGAAAGTTTACAATGCAGTCTCGAGACTGCATTGTAAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1541s1c1
Sequence:CCGGCCTCGAATTGTCTTCCAGTATCTCGAGATACTGGAAGACAATTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013246.2-802s1c1
Sequence:CCGGCAACCGGCTCAAGAAGAAGATCTCGAGATCTTCTTCTTGAGCCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013246.2-809s1c1
Sequence:CCGGCTCAAGAAGAAGATGCAGCCTCTCGAGAGGCTGCATCTTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013246.2-478s1c1
Sequence:CCGGGCGAAGCCTCAATGACAAACTCTCGAGAGTTTGTCATTGAGGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1354s1c1
Sequence:CCGGCATGGTGGCAATTCTACACAACTCGAGTTGTGTAGAATTGCCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1092s1c1
Sequence:CCGGCCTGTTTCTACAGGAAGTCATCTCGAGATGACTTCCTGTAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1637s1c1
Sequence:CCGGCCACAGGATTTCCTGAAAGTTCTCGAGAACTTTCAGGAAATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013246
CLCF1 MISSION shRNA Lentiviral Transduction Particles
cardiotrophin-like cytokine factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1346s1c1
Sequence:CCGGGAAACAAACATGGTGGCAATTCTCGAGAATTGCCACCATGTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013246.2-1648s1c1
Sequence:CCGGCCTGAAAGTTTACAATGCAGTCTCGAGACTGCATTGTAAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1541s1c1
Sequence:CCGGCCTCGAATTGTCTTCCAGTATCTCGAGATACTGGAAGACAATTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013246.2-802s1c1
Sequence:CCGGCAACCGGCTCAAGAAGAAGATCTCGAGATCTTCTTCTTGAGCCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013246.2-809s1c1
Sequence:CCGGCTCAAGAAGAAGATGCAGCCTCTCGAGAGGCTGCATCTTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013246.2-478s1c1
Sequence:CCGGGCGAAGCCTCAATGACAAACTCTCGAGAGTTTGTCATTGAGGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1354s1c1
Sequence:CCGGCATGGTGGCAATTCTACACAACTCGAGTTGTGTAGAATTGCCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1092s1c1
Sequence:CCGGCCTGTTTCTACAGGAAGTCATCTCGAGATGACTTCCTGTAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013246.2-1637s1c1
Sequence:CCGGCCACAGGATTTCCTGAAAGTTCTCGAGAACTTTCAGGAAATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks