EMAIL THIS PAGE TO A FRIEND

CLCN1

chloride channel, voltage-sensitive 1

78 Gene Product Result for
Synonyms: CLC1
UniProtKB ID: P35523, A4D2H5, Q2M202
Gene ID:
Human(1180) Summary: The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Mouse(12723) chloride channel 1
Rat(25688) chloride channel, voltage-sensitive 1
chicken(427949) chloride channel, voltage-sensitive 1
Horse(100050692) chloride channel, voltage-sensitive 1
cow(514597) chloride channel 1, skeletal muscle
domestic cat(101088564) chloride channel, voltage-sensitive 1
dog(403723) chloride channel, voltage-sensitive 1
Goat(100750232) chloride channel, voltage-sensitive 1
sheep(101115453) chloride channel, voltage-sensitive 1
Domestic Rabbit(100349073) chloride channel, voltage-sensitive 1
domestic guinea pig(100733719) chloride channel, voltage-sensitive 1
naked mole-rat(101709093) chloride channel, voltage-sensitive 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000083 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000083 Rosetta Predictions human pricing
NM_013147 Rosetta Predictions rat pricing
NM_013491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301831 predicted 2466
2 SASI_Hs01_00175347 predicted 862
3 SASI_Hs01_00175348 predicted 1718
4 SASI_Hs01_00175349 predicted 2749
5 SASI_Hs01_00175350 predicted 2571
6 SASI_Hs01_00175351 predicted 1354
7 SASI_Hs01_00175352 predicted 1085
8 SASI_Hs01_00175353 predicted 586
9 SASI_Hs01_00175354 predicted 1874
10 SASI_Hs01_00175355 predicted 1584
11 SASI_Hs01_00175346 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035271 predicted 1602
2 SASI_Rn01_00035273 predicted 357
3 SASI_Rn01_00035274 predicted 327
4 SASI_Rn01_00035275 predicted 2583
5 SASI_Rn01_00035276 predicted 2819
6 SASI_Rn02_00260948 predicted 1953
7 SASI_Rn01_00035277 predicted 1976
8 SASI_Rn01_00035278 predicted 1380
9 SASI_Rn01_00035279 predicted 1082
10 SASI_Rn01_00035280 predicted 1342
11 SASI_Rn01_00035272 predicted 2613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180227 predicted 1572
2 SASI_Mm01_00180228 predicted 1238
3 SASI_Mm01_00180229 predicted 1717
4 SASI_Mm01_00180230 predicted 1582
5 SASI_Mm01_00180231 predicted 354
6 SASI_Mm01_00180232 predicted 2582
7 SASI_Mm01_00180233 predicted 1080
8 SASI_Mm01_00180234 predicted 1971
9 SASI_Mm01_00180235 predicted 1252
10 SASI_Mm01_00180236 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000083
CLCN1 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-661s1c1
Sequence:CCGGCCCGAAATGAAGACAATACTTCTCGAGAAGTATTGTCTTCATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-1878s1c1
Sequence:CCGGGCTCAGCAAATATACCATCTTCTCGAGAAGATGGTATATTTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-1714s1c1
Sequence:CCGGGCTGTGATTTGCTTCGAATTACTCGAGTAATTCGAAGCAAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-259s1c1
Sequence:CCGGCCCACACAGATTTATGGCCATCTCGAGATGGCCATAAATCTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-2756s1c1
Sequence:CCGGCGACTTCAACTCGAAAGAGTACTCGAGTACTCTTTCGAGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000083.2-1306s21c1
Sequence:CCGGCCACCAGGAATGGGTCAATTCCTCGAGGAATTGACCCATTCCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000083.2-361s21c1
Sequence:CCGGGATGAGGATCACTATTCTAAACTCGAGTTTAGAATAGTGATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000083.2-1090s21c1
Sequence:CCGGACCAATTTCCGAATGGATTTCCTCGAGGAAATCCATTCGGAAATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000083
CLCN1 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-661s1c1
Sequence:CCGGCCCGAAATGAAGACAATACTTCTCGAGAAGTATTGTCTTCATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-1878s1c1
Sequence:CCGGGCTCAGCAAATATACCATCTTCTCGAGAAGATGGTATATTTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-1714s1c1
Sequence:CCGGGCTGTGATTTGCTTCGAATTACTCGAGTAATTCGAAGCAAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-259s1c1
Sequence:CCGGCCCACACAGATTTATGGCCATCTCGAGATGGCCATAAATCTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-2756s1c1
Sequence:CCGGCGACTTCAACTCGAAAGAGTACTCGAGTACTCTTTCGAGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000083.2-1306s21c1
Sequence:CCGGCCACCAGGAATGGGTCAATTCCTCGAGGAATTGACCCATTCCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000083.2-361s21c1
Sequence:CCGGGATGAGGATCACTATTCTAAACTCGAGTTTAGAATAGTGATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000083.2-1090s21c1
Sequence:CCGGACCAATTTCCGAATGGATTTCCTCGAGGAAATCCATTCGGAAATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000083
CLCN1 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-661s1c1
Sequence:CCGGCCCGAAATGAAGACAATACTTCTCGAGAAGTATTGTCTTCATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-1878s1c1
Sequence:CCGGGCTCAGCAAATATACCATCTTCTCGAGAAGATGGTATATTTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-1714s1c1
Sequence:CCGGGCTGTGATTTGCTTCGAATTACTCGAGTAATTCGAAGCAAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-259s1c1
Sequence:CCGGCCCACACAGATTTATGGCCATCTCGAGATGGCCATAAATCTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000083.1-2756s1c1
Sequence:CCGGCGACTTCAACTCGAAAGAGTACTCGAGTACTCTTTCGAGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000083.2-1306s21c1
Sequence:CCGGCCACCAGGAATGGGTCAATTCCTCGAGGAATTGACCCATTCCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000083.2-361s21c1
Sequence:CCGGGATGAGGATCACTATTCTAAACTCGAGTTTAGAATAGTGATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000083.2-1090s21c1
Sequence:CCGGACCAATTTCCGAATGGATTTCCTCGAGGAAATCCATTCGGAAATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013491
CLCN1 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-2200s1c1
Sequence:CCGGGCCTTCGTAGATGAAGATGAACTCGAGTTCATCTTCATCTACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013491.1-3365s1c1
Sequence:CCGGCCTGCCTGTTTATATTCAGTTCTCGAGAACTGAATATAAACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-1464s1c1
Sequence:CCGGCCTTCTCTTCTTCGTTATGAACTCGAGTTCATAACGAAGAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-861s1c1
Sequence:CCGGGCCATACTATTACACTGACATCTCGAGATGTCAGTGTAATAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-2686s1c1
Sequence:CCGGGCACTAGAAGAGCTACAGAAACTCGAGTTTCTGTAGCTCTTCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013491.2-1242s21c1
Sequence:CCGGCTAAGCACCGCCTGCTATATCCTCGAGGATATAGCAGGCGGTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013491.2-2749s21c1
Sequence:CCGGACTTGCCAGCTTCCGGAATACCTCGAGGTATTCCGGAAGCTGGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013491.2-1710s21c1
Sequence:CCGGCCGTCATTTGCTTCGAATTAACTCGAGTTAATTCGAAGCAAATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013491
CLCN1 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-2200s1c1
Sequence:CCGGGCCTTCGTAGATGAAGATGAACTCGAGTTCATCTTCATCTACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013491.1-3365s1c1
Sequence:CCGGCCTGCCTGTTTATATTCAGTTCTCGAGAACTGAATATAAACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-1464s1c1
Sequence:CCGGCCTTCTCTTCTTCGTTATGAACTCGAGTTCATAACGAAGAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-861s1c1
Sequence:CCGGGCCATACTATTACACTGACATCTCGAGATGTCAGTGTAATAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-2686s1c1
Sequence:CCGGGCACTAGAAGAGCTACAGAAACTCGAGTTTCTGTAGCTCTTCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013491.2-1242s21c1
Sequence:CCGGCTAAGCACCGCCTGCTATATCCTCGAGGATATAGCAGGCGGTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013491.2-2749s21c1
Sequence:CCGGACTTGCCAGCTTCCGGAATACCTCGAGGTATTCCGGAAGCTGGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013491.2-1710s21c1
Sequence:CCGGCCGTCATTTGCTTCGAATTAACTCGAGTTAATTCGAAGCAAATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013491
CLCN1 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-2200s1c1
Sequence:CCGGGCCTTCGTAGATGAAGATGAACTCGAGTTCATCTTCATCTACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013491.1-3365s1c1
Sequence:CCGGCCTGCCTGTTTATATTCAGTTCTCGAGAACTGAATATAAACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-1464s1c1
Sequence:CCGGCCTTCTCTTCTTCGTTATGAACTCGAGTTCATAACGAAGAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-861s1c1
Sequence:CCGGGCCATACTATTACACTGACATCTCGAGATGTCAGTGTAATAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013491.1-2686s1c1
Sequence:CCGGGCACTAGAAGAGCTACAGAAACTCGAGTTTCTGTAGCTCTTCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013491.2-1242s21c1
Sequence:CCGGCTAAGCACCGCCTGCTATATCCTCGAGGATATAGCAGGCGGTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013491.2-2749s21c1
Sequence:CCGGACTTGCCAGCTTCCGGAATACCTCGAGGTATTCCGGAAGCTGGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013491.2-1710s21c1
Sequence:CCGGCCGTCATTTGCTTCGAATTAACTCGAGTTAATTCGAAGCAAATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks