EMAIL THIS PAGE TO A FRIEND

CLCN2

chloride channel, voltage-sensitive 2

Synonyms: CIC-2 CLC2 ECA2 ECA3 EGI11 EGI3 EGMA EJM6 EJM8 clC-2
Gene ID:
Human(1181) Summary: This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
Mouse(12724) chloride channel 2
Rat(29232) chloride channel, voltage-sensitive 2
chicken(425295) chloride channel, voltage-sensitive 2
Horse(100067143) chloride channel, voltage-sensitive 2
cow(505569) chloride channel 2
domestic cat(101084647) chloride channel, voltage-sensitive 2
dog(488106) chloride channel, voltage-sensitive 2
naked mole-rat(101708110) chloride channel, voltage-sensitive 2
domestic guinea pig(100135500) chloride channel 2
sheep(100125625) chloride channel, voltage-sensitive 2
Domestic Rabbit(100009530) chloride channel, voltage-sensitive 2
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004366 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004366 Rosetta Predictions human pricing
NM_017137 Rosetta Predictions rat pricing
NM_009900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192344 predicted 925
2 SASI_Hs01_00192345 predicted 810
3 SASI_Hs01_00192346 predicted 659
4 SASI_Hs01_00192347 predicted 1020
5 SASI_Hs02_00337433 predicted 2469
6 SASI_Hs01_00192348 predicted 668
7 SASI_Hs01_00192349 predicted 879
8 SASI_Hs01_00192350 predicted 1144
9 SASI_Hs01_00192352 predicted 1668
10 SASI_Hs01_00192353 predicted 1947
11 SASI_Hs01_00192351 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079160 predicted 1661
2 SASI_Rn01_00079161 predicted 1736
3 SASI_Rn01_00079163 predicted 1994
4 SASI_Rn02_00261383 predicted 560
5 SASI_Rn01_00079164 predicted 2446
6 SASI_Rn01_00079165 predicted 2324
7 SASI_Rn01_00079166 predicted 1640
8 SASI_Rn01_00079167 predicted 1422
9 SASI_Rn01_00079168 predicted 2524
10 SASI_Rn01_00079169 predicted 1213
11 SASI_Rn01_00079162 predicted 2010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028103 predicted 1000
2 SASI_Mm01_00028104 predicted 2219
3 SASI_Mm01_00028106 predicted 2133
4 SASI_Mm01_00028105 predicted 2126
5 SASI_Mm01_00028108 predicted 2049
6 SASI_Mm01_00028109 predicted 2215
7 SASI_Mm01_00028110 predicted 1844
8 SASI_Mm01_00028111 predicted 1214
9 SASI_Mm01_00028112 predicted 2924
10 SASI_Mm02_00317403 predicted 2490
11 SASI_Mm01_00028107 predicted 2350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009900
CLCN2 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009900.2-3198s21c1
Sequence:CCGGGTCACAGCACAGGGTGTTAAACTCGAGTTTAACACCCTGTGCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009900.2-2664s21c1
Sequence:CCGGCCTAGCTCCGAGACATCTATCCTCGAGGATAGATGTCTCGGAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-2597s1c1
Sequence:CCGGCCATGCTTATGTCACCAGCATCTCGAGATGCTGGTGACATAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-1326s1c1
Sequence:CCGGGAGACCCTAGTCACTCTGTTTCTCGAGAAACAGAGTGACTAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-1790s1c1
Sequence:CCGGGCCATCGCTCTATGACAGTATCTCGAGATACTGTCATAGAGCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009900.1-2994s1c1
Sequence:CCGGGCAGAACTAAACTGGGTTTATCTCGAGATAAACCCAGTTTAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-349s1c1
Sequence:CCGGGTGCCAGATGTCGCATTTGTTCTCGAGAACAAATGCGACATCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009900
CLCN2 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009900.2-3198s21c1
Sequence:CCGGGTCACAGCACAGGGTGTTAAACTCGAGTTTAACACCCTGTGCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009900.2-2664s21c1
Sequence:CCGGCCTAGCTCCGAGACATCTATCCTCGAGGATAGATGTCTCGGAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-2597s1c1
Sequence:CCGGCCATGCTTATGTCACCAGCATCTCGAGATGCTGGTGACATAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-1326s1c1
Sequence:CCGGGAGACCCTAGTCACTCTGTTTCTCGAGAAACAGAGTGACTAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-1790s1c1
Sequence:CCGGGCCATCGCTCTATGACAGTATCTCGAGATACTGTCATAGAGCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009900.1-2994s1c1
Sequence:CCGGGCAGAACTAAACTGGGTTTATCTCGAGATAAACCCAGTTTAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-349s1c1
Sequence:CCGGGTGCCAGATGTCGCATTTGTTCTCGAGAACAAATGCGACATCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009900
CLCN2 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009900.2-3198s21c1
Sequence:CCGGGTCACAGCACAGGGTGTTAAACTCGAGTTTAACACCCTGTGCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009900.2-2664s21c1
Sequence:CCGGCCTAGCTCCGAGACATCTATCCTCGAGGATAGATGTCTCGGAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-2597s1c1
Sequence:CCGGCCATGCTTATGTCACCAGCATCTCGAGATGCTGGTGACATAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-1326s1c1
Sequence:CCGGGAGACCCTAGTCACTCTGTTTCTCGAGAAACAGAGTGACTAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-1790s1c1
Sequence:CCGGGCCATCGCTCTATGACAGTATCTCGAGATACTGTCATAGAGCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009900.1-2994s1c1
Sequence:CCGGGCAGAACTAAACTGGGTTTATCTCGAGATAAACCCAGTTTAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009900.1-349s1c1
Sequence:CCGGGTGCCAGATGTCGCATTTGTTCTCGAGAACAAATGCGACATCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004366
CLCN2 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004366.4-1092s21c1
Sequence:CCGGCCTTTGCTGTCATTGGTATTGCTCGAGCAATACCAATGACAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004366.4-2602s21c1
Sequence:CCGGCATTGGAATCGTTACTCTAAACTCGAGTTTAGAGTAACGATTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004366.4-805s21c1
Sequence:CCGGGGGTATCTATGAGAATGAATCCTCGAGGATTCATTCTCATAGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-432s1c1
Sequence:CCGGCATCACTTTCTCAGCCGGATTCTCGAGAATCCGGCTGAGAAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-492s1c1
Sequence:CCGGCCCTGAGATGAAGACCATCTTCTCGAGAAGATGGTCTTCATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-2331s1c1
Sequence:CCGGGCAACTAGATGAACCTGTCAACTCGAGTTGACAGGTTCATCTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-1302s1c1
Sequence:CCGGCCTGGTCATCTTCATTCTCATCTCGAGATGAGAATGAAGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004366
CLCN2 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004366.4-1092s21c1
Sequence:CCGGCCTTTGCTGTCATTGGTATTGCTCGAGCAATACCAATGACAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004366.4-2602s21c1
Sequence:CCGGCATTGGAATCGTTACTCTAAACTCGAGTTTAGAGTAACGATTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004366.4-805s21c1
Sequence:CCGGGGGTATCTATGAGAATGAATCCTCGAGGATTCATTCTCATAGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-432s1c1
Sequence:CCGGCATCACTTTCTCAGCCGGATTCTCGAGAATCCGGCTGAGAAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-492s1c1
Sequence:CCGGCCCTGAGATGAAGACCATCTTCTCGAGAAGATGGTCTTCATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-2331s1c1
Sequence:CCGGGCAACTAGATGAACCTGTCAACTCGAGTTGACAGGTTCATCTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-1302s1c1
Sequence:CCGGCCTGGTCATCTTCATTCTCATCTCGAGATGAGAATGAAGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004366
CLCN2 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004366.4-1092s21c1
Sequence:CCGGCCTTTGCTGTCATTGGTATTGCTCGAGCAATACCAATGACAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004366.4-2602s21c1
Sequence:CCGGCATTGGAATCGTTACTCTAAACTCGAGTTTAGAGTAACGATTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004366.4-805s21c1
Sequence:CCGGGGGTATCTATGAGAATGAATCCTCGAGGATTCATTCTCATAGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-432s1c1
Sequence:CCGGCATCACTTTCTCAGCCGGATTCTCGAGAATCCGGCTGAGAAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-492s1c1
Sequence:CCGGCCCTGAGATGAAGACCATCTTCTCGAGAAGATGGTCTTCATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-2331s1c1
Sequence:CCGGGCAACTAGATGAACCTGTCAACTCGAGTTGACAGGTTCATCTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004366.2-1302s1c1
Sequence:CCGGCCTGGTCATCTTCATTCTCATCTCGAGATGAGAATGAAGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks