EMAIL THIS PAGE TO A FRIEND

CLCN3

chloride channel, voltage-sensitive 3

208 Gene Product Result for
Synonyms: CLC3 ClC-3
UniProtKB ID: P51790, B7Z932, D3DP34, O14918, Q86Z21
Gene ID:
Human(1182) Summary: This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Mouse(12725) chloride channel 3
Rat(84360) chloride channel, voltage-sensitive 3
sheep(101114498) chloride channel, voltage-sensitive 3
Domestic Rabbit(100008673) chloride channel, voltage-sensitive 3
domestic guinea pig(100135501) chloride channel 3
naked mole-rat(101704112) chloride channel, voltage-sensitive 3
Zebrafish(559340) chloride channel 3
cow(522719) chloride channel 3
Horse(100061225) chloride channel, voltage-sensitive 3
domestic cat(101092513) chloride channel, voltage-sensitive 3
dog(477354) chloride channel, voltage-sensitive 3
chicken(422432) chloride channel, voltage-sensitive 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C9602 Anti-Chloride Channel-3 (CLC-3, Clcn3) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat
western blot pricing
SAB2108499 Anti-CLCN3 IgG fraction of antiserum bovine, rabbit, sheep, bovine, pig, horse, guinea pig, zebrafish, canine, mouse, rat
immunohistochemistry, western blot pricing
SAB1305009 ANTI-CLCN3 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV35504 Anti-CLCN3 antibody produced in rabbit IgG fraction of antiserum sheep, mouse, guinea pig, human, rabbit, rat, canine, rabbit, pig, horse, zebrafish
immunohistochemistry, western blot pricing
HPA044723 Anti-CLCN3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB5200519 Monoclonal Anti-Clcn3 - Alkaline Phosphatase antibody produced in mouse clone S258-5, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200520 Monoclonal Anti-Clcn3 - Apc antibody produced in mouse clone S258-5, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200511 Monoclonal Anti-Clcn3 - Atto 390 antibody produced in mouse clone S258-5, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200512 Monoclonal Anti-Clcn3 - Atto 488 antibody produced in mouse clone S258-5, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200513 Monoclonal Anti-Clcn3 - Atto 565 antibody produced in mouse clone S258-5, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200514 Monoclonal Anti-Clcn3 - Atto 594 antibody produced in mouse clone S258-5, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200515 Monoclonal Anti-Clcn3 - Atto 633 antibody produced in mouse clone S258-5, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200516 Monoclonal Anti-Clcn3 - Atto 655 antibody produced in mouse clone S258-5, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200517 Monoclonal Anti-Clcn3 - Atto 680 antibody produced in mouse clone S258-5, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200518 Monoclonal Anti-Clcn3 - Atto 700 antibody produced in mouse clone S258-5, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200521 Monoclonal Anti-Clcn3 - Biotin antibody produced in mouse clone S258-5, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200522 Monoclonal Anti-Clcn3 - Fitc antibody produced in mouse clone S258-5, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200523 Monoclonal Anti-Clcn3 - Hrp antibody produced in mouse clone S258-5, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200524 Monoclonal Anti-Clcn3 - Pe/Atto 594 antibody produced in mouse clone S258-5, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200525 Monoclonal Anti-Clcn3 - Percp antibody produced in mouse clone S258-5, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200526 Monoclonal Anti-Clcn3 - Rpe antibody produced in mouse clone S258-5, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200527 Monoclonal Anti-Clcn3 - Streptavidin antibody produced in mouse clone S258-5, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200510 Monoclonal Anti-Clcn3 antibody produced in mouse clone S258-5, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001829 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001829 Rosetta Predictions human pricing
NM_173872 Rosetta Predictions human pricing
NM_053363 Rosetta Predictions rat pricing
NM_007711 Rosetta Predictions mouse pricing
NM_173873 Rosetta Predictions mouse pricing
NM_173874 Rosetta Predictions mouse pricing
NM_173876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012674 predicted 1493
2 SASI_Hs01_00012675 predicted 1040
3 SASI_Hs01_00012676 predicted 2403
4 SASI_Hs01_00012677 predicted 2006
5 SASI_Hs01_00012678 predicted 740
6 SASI_Hs02_00332631 predicted 2153
7 SASI_Hs01_00012680 predicted 985
8 SASI_Hs02_00332632 predicted 1026
9 SASI_Hs01_00012682 predicted 2518
10 SASI_Hs01_00012683 predicted 956
11 SASI_Hs01_00012679 predicted 1853
12 SASI_Hs01_00012681 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162069 predicted 1493
2 SASI_Hs01_00162070 predicted 1047
3 SASI_Hs01_00162071 predicted 2401
4 SASI_Hs01_00162072 predicted 2011
5 SASI_Hs01_00162073 predicted 731
6 SASI_Hs02_00368741 predicted 2157
7 SASI_Hs01_00162075 predicted 984
8 SASI_Hs02_00368742 predicted 1029
9 SASI_Hs01_00162077 predicted 2519
10 SASI_Hs01_00162078 predicted 955
11 SASI_Hs01_00162074 predicted 1856
12 SASI_Hs01_00162076 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051524 predicted 1467
2 SASI_Rn01_00051525 predicted 736
3 SASI_Rn02_00265837 predicted 888
4 SASI_Rn01_00051526 predicted 2221
5 SASI_Rn02_00265838 predicted 297
6 SASI_Rn01_00051528 predicted 2258
7 SASI_Rn01_00051529 predicted 2101
8 SASI_Rn01_00051530 predicted 1707
9 SASI_Rn01_00051531 predicted 1565
10 SASI_Rn02_00265839 predicted 282
11 SASI_Rn01_00051527 predicted 1068
12 SASI_Rn01_00051532 predicted 1098
13 SASI_Rn01_00051533 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070012 predicted 2432
2 SASI_Mm01_00070013 predicted 2341
3 SASI_Mm01_00070014 predicted 2274
4 SASI_Mm01_00070015 predicted 1730
5 SASI_Mm02_00312276 predicted 1665
6 SASI_Mm02_00312277 predicted 2183
7 SASI_Mm01_00070016 predicted 1756
8 SASI_Mm02_00312278 predicted 2023
9 SASI_Mm01_00070017 predicted 2118
10 SASI_Mm01_00070018 predicted 1643
11 SASI_Mm01_00070019 predicted 1868
12 SASI_Mm01_00070020 predicted 909
13 SASI_Mm01_00070021 predicted 2239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345467 predicted 2613
2 SASI_Mm02_00345468 predicted 2514
3 SASI_Mm02_00345469 predicted 2453
4 SASI_Mm02_00345470 predicted 1910
5 SASI_Mm02_00345471 predicted 1839
6 SASI_Mm02_00345472 predicted 2355
7 SASI_Mm02_00345473 predicted 1929
8 SASI_Mm02_00345474 predicted 2200
9 SASI_Mm02_00345475 predicted 2295
10 SASI_Mm02_00345476 predicted 1813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345477 predicted 2605
2 SASI_Mm02_00345478 predicted 2514
3 SASI_Mm02_00345479 predicted 2454
4 SASI_Mm02_00345480 predicted 1910
5 SASI_Mm02_00345481 predicted 1838
6 SASI_Mm02_00345482 predicted 2355
7 SASI_Mm02_00345483 predicted 1927
8 SASI_Mm02_00345484 predicted 2197
9 SASI_Mm02_00345485 predicted 2297
10 SASI_Mm02_00345486 predicted 1820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193081 predicted 2153
2 SASI_Mm01_00193082 predicted 2062
3 SASI_Mm01_00193083 predicted 1995
4 SASI_Mm01_00193084 predicted 1455
5 SASI_Mm02_00345487 predicted 1381
6 SASI_Mm02_00345488 predicted 1896
7 SASI_Mm01_00193085 predicted 1477
8 SASI_Mm02_00345489 predicted 1743
9 SASI_Mm01_00193086 predicted 1839
10 SASI_Mm01_00193087 predicted 1364
11 SASI_Mm01_00193088 predicted 1577
12 SASI_Mm01_00193089 predicted 613
13 SASI_Mm01_00193090 predicted 1935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001829
VALIDATED
CLCN3 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001829.1-3504s1c1
Sequence:CCGGGCTGTAACAAAGCCTCTTTAACTCGAGTTAAAGAGGCTTTGTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001829.1-1068s1c1
Sequence:CCGGGCAGAATTAATCATAGGTCAACTCGAGTTGACCTATGATTAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001829.1-2390s1c1
Sequence:CCGGCCGATTAAATGGATACCCTTTCTCGAGAAAGGGTATCCATTTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001829.1-1551s1c1
Sequence:CCGGGCTGCTTTAGTGGCTGCATTTCTCGAGAAATGCAGCCACTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001829.1-1378s1c1
Sequence:CCGGCCTACCTCTTTCCAAAGTATACTCGAGTATACTTTGGAAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001829.2-1399s21c1
Sequence:CCGGCCTACCTCTTTCCAAAGTATACTCGAGTATACTTTGGAAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001829.2-2411s21c1
Sequence:CCGGCCGATTAAATGGATACCCTTTCTCGAGAAAGGGTATCCATTTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001829.2-3534s21c1
Sequence:CCGGGCTGTAACAAAGCCTCTTTAACTCGAGTTAAAGAGGCTTTGTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001829.2-2016s21c1
Sequence:CCGGTTATGCCTGGCACTCATATTTCTCGAGAAATATGAGTGCCAGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001829.2-1758s21c1
Sequence:CCGGCGACGCAAGTCCACGAAATTTCTCGAGAAATTTCGTGGACTTGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001829
VALIDATED
CLCN3 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001829.1-3504s1c1
Sequence:CCGGGCTGTAACAAAGCCTCTTTAACTCGAGTTAAAGAGGCTTTGTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001829.1-1068s1c1
Sequence:CCGGGCAGAATTAATCATAGGTCAACTCGAGTTGACCTATGATTAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001829.1-2390s1c1
Sequence:CCGGCCGATTAAATGGATACCCTTTCTCGAGAAAGGGTATCCATTTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001829.1-1551s1c1
Sequence:CCGGGCTGCTTTAGTGGCTGCATTTCTCGAGAAATGCAGCCACTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001829.1-1378s1c1
Sequence:CCGGCCTACCTCTTTCCAAAGTATACTCGAGTATACTTTGGAAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001829.2-1399s21c1
Sequence:CCGGCCTACCTCTTTCCAAAGTATACTCGAGTATACTTTGGAAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001829.2-2411s21c1
Sequence:CCGGCCGATTAAATGGATACCCTTTCTCGAGAAAGGGTATCCATTTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001829.2-3534s21c1
Sequence:CCGGGCTGTAACAAAGCCTCTTTAACTCGAGTTAAAGAGGCTTTGTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001829.2-2016s21c1
Sequence:CCGGTTATGCCTGGCACTCATATTTCTCGAGAAATATGAGTGCCAGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001829.2-1758s21c1
Sequence:CCGGCGACGCAAGTCCACGAAATTTCTCGAGAAATTTCGTGGACTTGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001829
VALIDATED
CLCN3 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001829.1-3504s1c1
Sequence:CCGGGCTGTAACAAAGCCTCTTTAACTCGAGTTAAAGAGGCTTTGTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001829.1-1068s1c1
Sequence:CCGGGCAGAATTAATCATAGGTCAACTCGAGTTGACCTATGATTAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001829.1-2390s1c1
Sequence:CCGGCCGATTAAATGGATACCCTTTCTCGAGAAAGGGTATCCATTTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001829.1-1551s1c1
Sequence:CCGGGCTGCTTTAGTGGCTGCATTTCTCGAGAAATGCAGCCACTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001829.1-1378s1c1
Sequence:CCGGCCTACCTCTTTCCAAAGTATACTCGAGTATACTTTGGAAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001829.2-1399s21c1
Sequence:CCGGCCTACCTCTTTCCAAAGTATACTCGAGTATACTTTGGAAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001829.2-2411s21c1
Sequence:CCGGCCGATTAAATGGATACCCTTTCTCGAGAAAGGGTATCCATTTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001829.2-3534s21c1
Sequence:CCGGGCTGTAACAAAGCCTCTTTAACTCGAGTTAAAGAGGCTTTGTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001829.2-2016s21c1
Sequence:CCGGTTATGCCTGGCACTCATATTTCTCGAGAAATATGAGTGCCAGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001829.2-1758s21c1
Sequence:CCGGCGACGCAAGTCCACGAAATTTCTCGAGAAATTTCGTGGACTTGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007711
VALIDATED
CLCN3 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007711.1-1680s1c1
Sequence:CCGGCGTTGGAGTATATTCAGCTATCTCGAGATAGCTGAATATACTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-2404s1c1
Sequence:CCGGGCACAGCATACTCCATCTCTTCTCGAGAAGAGATGGAGTATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-452s1c1
Sequence:CCGGCCTACGATGATTTCCATACTACTCGAGTAGTATGGAAATCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-2103s1c1
Sequence:CCGGCCGACTAAATGGGTACCCTTTCTCGAGAAAGGGTACCCATTTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-1102s1c1
Sequence:CCGGCCAAAGTATAGCACCAATGAACTCGAGTTCATTGGTGCTATACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-979s21c1
Sequence:CCGGAGAGGGCCCTGGATCTTATATCTCGAGATATAAGATCCAGGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-2741s21c1
Sequence:CCGGGGACGCCTCCTTGGCATTATACTCGAGTATAATGCCAAGGAGGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007711.3-1625s21c1
Sequence:CCGGCGACGCAAGTCCACCAAATTTCTCGAGAAATTTGGTGGACTTGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-629s21c1
Sequence:CCGGTACGATGATTTCCATACTATTCTCGAGAATAGTATGGAAATCATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-3240s21c1
Sequence:CCGGTTGAATTGAGCCATCTATTAACTCGAGTTAATAGATGGCTCAATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-1883s21c1
Sequence:CCGGTTGTGCCTAGCGCTCATATTTCTCGAGAAATATGAGCGCTAGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007711
VALIDATED
CLCN3 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007711.1-1680s1c1
Sequence:CCGGCGTTGGAGTATATTCAGCTATCTCGAGATAGCTGAATATACTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-2404s1c1
Sequence:CCGGGCACAGCATACTCCATCTCTTCTCGAGAAGAGATGGAGTATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-452s1c1
Sequence:CCGGCCTACGATGATTTCCATACTACTCGAGTAGTATGGAAATCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-2103s1c1
Sequence:CCGGCCGACTAAATGGGTACCCTTTCTCGAGAAAGGGTACCCATTTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-1102s1c1
Sequence:CCGGCCAAAGTATAGCACCAATGAACTCGAGTTCATTGGTGCTATACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-979s21c1
Sequence:CCGGAGAGGGCCCTGGATCTTATATCTCGAGATATAAGATCCAGGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-2741s21c1
Sequence:CCGGGGACGCCTCCTTGGCATTATACTCGAGTATAATGCCAAGGAGGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007711.3-1625s21c1
Sequence:CCGGCGACGCAAGTCCACCAAATTTCTCGAGAAATTTGGTGGACTTGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-629s21c1
Sequence:CCGGTACGATGATTTCCATACTATTCTCGAGAATAGTATGGAAATCATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-3240s21c1
Sequence:CCGGTTGAATTGAGCCATCTATTAACTCGAGTTAATAGATGGCTCAATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-1883s21c1
Sequence:CCGGTTGTGCCTAGCGCTCATATTTCTCGAGAAATATGAGCGCTAGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007711
VALIDATED
CLCN3 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007711.1-1680s1c1
Sequence:CCGGCGTTGGAGTATATTCAGCTATCTCGAGATAGCTGAATATACTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-2404s1c1
Sequence:CCGGGCACAGCATACTCCATCTCTTCTCGAGAAGAGATGGAGTATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-452s1c1
Sequence:CCGGCCTACGATGATTTCCATACTACTCGAGTAGTATGGAAATCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-2103s1c1
Sequence:CCGGCCGACTAAATGGGTACCCTTTCTCGAGAAAGGGTACCCATTTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007711.1-1102s1c1
Sequence:CCGGCCAAAGTATAGCACCAATGAACTCGAGTTCATTGGTGCTATACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-979s21c1
Sequence:CCGGAGAGGGCCCTGGATCTTATATCTCGAGATATAAGATCCAGGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-2741s21c1
Sequence:CCGGGGACGCCTCCTTGGCATTATACTCGAGTATAATGCCAAGGAGGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007711.3-1625s21c1
Sequence:CCGGCGACGCAAGTCCACCAAATTTCTCGAGAAATTTGGTGGACTTGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-629s21c1
Sequence:CCGGTACGATGATTTCCATACTATTCTCGAGAATAGTATGGAAATCATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-3240s21c1
Sequence:CCGGTTGAATTGAGCCATCTATTAACTCGAGTTAATAGATGGCTCAATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007711.3-1883s21c1
Sequence:CCGGTTGTGCCTAGCGCTCATATTTCTCGAGAAATATGAGCGCTAGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks