EMAIL THIS PAGE TO A FRIEND

CLCN4

chloride channel, voltage-sensitive 4

152 Gene Product Result for
Synonyms: CLC4 ClC-4 ClC-4A
UniProtKB ID: P51793, A1L3U1, Q9UBU1
Gene ID:
Human(1183) Summary: The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
Rat(60586) chloride channel, voltage-sensitive 4
Zebrafish(768175) chloride channel, voltage-sensitive 4
chicken(428005) chloride channel 4
Horse(100049933) chloride channel, voltage-sensitive 4
cow(511699) chloride channel 4
domestic cat(101088304) chloride channel, voltage-sensitive 4
dog(491736) chloride channel, voltage-sensitive 4
naked mole-rat(101702325) chloride channel, voltage-sensitive 4
domestic guinea pig(100714722) chloride channel, voltage-sensitive 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001830 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153601 MISSION® esiRNA esiRNA human CLCN4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001830 Rosetta Predictions human pricing
NM_022198 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103297 predicted 2023
2 SASI_Hs02_00332633 predicted 2378
3 SASI_Hs01_00103298 predicted 2192
4 SASI_Hs01_00103299 predicted 1467
5 SASI_Hs01_00103300 predicted 1331
6 SASI_Hs01_00103301 predicted 2135
7 SASI_Hs01_00103302 predicted 2156
8 SASI_Hs01_00103303 predicted 1542
9 SASI_Hs01_00103304 predicted 1790
10 SASI_Hs01_00103305 predicted 2422
11 SASI_Hs01_00103306 predicted 2506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116719 predicted 473
2 SASI_Rn01_00116720 predicted 2584
3 SASI_Rn01_00116721 predicted 1820
4 SASI_Rn01_00116722 predicted 2509
5 SASI_Rn01_00116723 predicted 1093
6 SASI_Rn01_00116724 predicted 694
7 SASI_Rn01_00116725 predicted 2528
8 SASI_Rn01_00116727 predicted 348
9 SASI_Rn01_00116728 predicted 1440
10 SASI_Rn02_00262949 predicted 697
11 SASI_Rn01_00116726 predicted 2607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001830
CLCN4 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001830.3-941s21c1
Sequence:CCGGGTGCGTGTATTTGCACCATATCTCGAGATATGGTGCAAATACACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001830.3-2713s21c1
Sequence:CCGGGCAACAAGGTGGCAATTATTTCTCGAGAAATAATTGCCACCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001830.3-2386s21c1
Sequence:CCGGGGAACTGATTCTCGCAATAAACTCGAGTTTATTGCGAGAATCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001830.3-3121s21c1
Sequence:CCGGGGCATGTCAGCGTCCTTATTTCTCGAGAAATAAGGACGCTGACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-2643s1c1
Sequence:CCGGCCCGAATCCATCATGTTTAATCTCGAGATTAAACATGATGGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-819s1c1
Sequence:CCGGGCCAGTGCTTACATTCTGAATCTCGAGATTCAGAATGTAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-1989s1c1
Sequence:CCGGGTGGTCATCATGTTTGAATTACTCGAGTAATTCAAACATGATGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-2111s1c1
Sequence:CCGGCCACTTAAATGGGTACCCTTTCTCGAGAAAGGGTACCCATTTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-719s1c1
Sequence:CCGGGCAGTGTTGCTGGACTTCTAACTCGAGTTAGAAGTCCAGCAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001830
CLCN4 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001830.3-941s21c1
Sequence:CCGGGTGCGTGTATTTGCACCATATCTCGAGATATGGTGCAAATACACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001830.3-2713s21c1
Sequence:CCGGGCAACAAGGTGGCAATTATTTCTCGAGAAATAATTGCCACCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001830.3-2386s21c1
Sequence:CCGGGGAACTGATTCTCGCAATAAACTCGAGTTTATTGCGAGAATCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001830.3-3121s21c1
Sequence:CCGGGGCATGTCAGCGTCCTTATTTCTCGAGAAATAAGGACGCTGACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-2643s1c1
Sequence:CCGGCCCGAATCCATCATGTTTAATCTCGAGATTAAACATGATGGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-819s1c1
Sequence:CCGGGCCAGTGCTTACATTCTGAATCTCGAGATTCAGAATGTAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-1989s1c1
Sequence:CCGGGTGGTCATCATGTTTGAATTACTCGAGTAATTCAAACATGATGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-2111s1c1
Sequence:CCGGCCACTTAAATGGGTACCCTTTCTCGAGAAAGGGTACCCATTTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-719s1c1
Sequence:CCGGGCAGTGTTGCTGGACTTCTAACTCGAGTTAGAAGTCCAGCAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001830
CLCN4 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001830.3-941s21c1
Sequence:CCGGGTGCGTGTATTTGCACCATATCTCGAGATATGGTGCAAATACACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001830.3-2713s21c1
Sequence:CCGGGCAACAAGGTGGCAATTATTTCTCGAGAAATAATTGCCACCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001830.3-2386s21c1
Sequence:CCGGGGAACTGATTCTCGCAATAAACTCGAGTTTATTGCGAGAATCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001830.3-3121s21c1
Sequence:CCGGGGCATGTCAGCGTCCTTATTTCTCGAGAAATAAGGACGCTGACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-2643s1c1
Sequence:CCGGCCCGAATCCATCATGTTTAATCTCGAGATTAAACATGATGGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-819s1c1
Sequence:CCGGGCCAGTGCTTACATTCTGAATCTCGAGATTCAGAATGTAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-1989s1c1
Sequence:CCGGGTGGTCATCATGTTTGAATTACTCGAGTAATTCAAACATGATGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-2111s1c1
Sequence:CCGGCCACTTAAATGGGTACCCTTTCTCGAGAAAGGGTACCCATTTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001830.2-719s1c1
Sequence:CCGGGCAGTGTTGCTGGACTTCTAACTCGAGTTAGAAGTCCAGCAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks