EMAIL THIS PAGE TO A FRIEND

CLCN5

chloride channel, voltage-sensitive 5

388 Gene Product Result for
Synonyms: CLC5 CLCK2 ClC-5 DENTS NPHL1 NPHL2 XLRH XRN hCIC-K2
UniProtKB ID: P51795, A1L475, B3KPN6, Q5JQD5, Q7RTN8
Gene ID:
Human(1184) Summary: This gene encodes a member of the ClC family of chloride ion channels and ion transporters. The encoded protein is primarily localized to endosomal membranes and may function to facilitate albumin uptake by the renal proximal tubule. Mutations in this gene have been found in Dent disease and renal tubular disorders complicated by nephrolithiasis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
Mouse(12728) chloride channel 5
Rat(25749) chloride channel, voltage-sensitive 5
sheep(101103039) chloride channel, voltage-sensitive 5
Domestic Rabbit(100008741) chloride channel, voltage-sensitive 5
chicken(422285) chloride channel 5
cow(493644) chloride channel 5
Horse(100052289) chloride channel, voltage-sensitive 5
domestic cat(101085351) chloride channel, voltage-sensitive 5
dog(491882) chloride channel, voltage-sensitive 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000084 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000084 Rosetta Predictions human pricing
NM_001127898 Rosetta Predictions human pricing
NM_001127899 Rosetta Predictions human pricing
NM_017106 Rosetta Predictions rat pricing
NM_016691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239872 predicted 580
2 SASI_Hs01_00239873 predicted 1683
3 SASI_Hs01_00239875 predicted 1299
4 SASI_Hs02_00301832 predicted 2536
5 SASI_Hs02_00301833 predicted 2518
6 SASI_Hs01_00239876 predicted 476
7 SASI_Hs01_00239877 predicted 371
8 SASI_Hs02_00301834 predicted 622
9 SASI_Hs01_00239879 predicted 382
10 SASI_Hs01_00239881 predicted 1962
11 SASI_Hs01_00239874 predicted 2585
12 SASI_Hs01_00239878 predicted 2568
13 SASI_Hs01_00239880 predicted 2308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330464 predicted 2035
2 SASI_Hs02_00330465 predicted 1641
3 SASI_Hs02_00330466 predicted 2887
4 SASI_Hs02_00330467 predicted 2860
5 SASI_Hs02_00330468 predicted 821
6 SASI_Hs02_00330469 predicted 712
7 SASI_Hs02_00330470 predicted 450
8 SASI_Hs02_00330471 predicted 468
9 SASI_Hs02_00330472 predicted 966
10 SASI_Hs02_00330473 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330474 predicted 2285
2 SASI_Hs02_00330475 predicted 1902
3 SASI_Hs02_00330476 predicted 3144
4 SASI_Hs02_00330477 predicted 3120
5 SASI_Hs02_00330478 predicted 1083
6 SASI_Hs02_00330479 predicted 971
7 SASI_Hs02_00330480 predicted 715
8 SASI_Hs02_00330481 predicted 727
9 SASI_Hs02_00330482 predicted 1231
10 SASI_Hs02_00330483 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261337 predicted 2006
2 SASI_Rn01_00110214 predicted 1930
3 SASI_Rn01_00110215 predicted 1102
4 SASI_Rn02_00261338 predicted 1357
5 SASI_Rn01_00110217 predicted 329
6 SASI_Rn01_00110218 predicted 1543
7 SASI_Rn01_00110219 predicted 769
8 SASI_Rn01_00110220 predicted 1068
9 SASI_Rn01_00110221 predicted 1169
10 SASI_Rn02_00261339 predicted 2091
11 SASI_Rn01_00110216 predicted 2096
12 SASI_Rn01_00110222 predicted 264
13 SASI_Rn01_00110223 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137304 predicted 1251
2 SASI_Mm01_00137305 predicted 356
3 SASI_Mm01_00137306 predicted 1334
4 SASI_Mm01_00137307 predicted 1160
5 SASI_Mm01_00137308 predicted 326
6 SASI_Mm01_00137309 predicted 1542
7 SASI_Mm01_00137310 predicted 1920
8 SASI_Mm01_00137311 predicted 256
9 SASI_Mm01_00137312 predicted 2383
10 SASI_Mm01_00137313 predicted 2435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016691
VALIDATED
CLCN5 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-1163s1c1
Sequence:CCGGCCATTCATTGTACTAGGCATACTCGAGTATGCCTAGTACAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-240s1c1
Sequence:CCGGCCTATGATGATTTCAACACAACTCGAGTTGTGTTGAAATCATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-1748s1c1
Sequence:CCGGCGGATGACTGTTTCTCTTGTTCTCGAGAACAAGAGAAACAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-437s1c1
Sequence:CCGGGCTCACTGGATGACAGACTTACTCGAGTAAGTCTGTCATCCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-658s1c1
Sequence:CCGGCCTTGCTGTATCTCTTGTCAACTCGAGTTGACAAGAGATACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-658s21c1
Sequence:CCGGCCTTGCTGTATCTCTTGTCAACTCGAGTTGACAAGAGATACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-1748s21c1
Sequence:CCGGCGGATGACTGTTTCTCTTGTTCTCGAGAACAAGAGAAACAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-240s21c1
Sequence:CCGGCCTATGATGATTTCAACACAACTCGAGTTGTGTTGAAATCATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-1163s21c1
Sequence:CCGGCCATTCATTGTACTAGGCATACTCGAGTATGCCTAGTACAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016691
VALIDATED
CLCN5 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-1163s1c1
Sequence:CCGGCCATTCATTGTACTAGGCATACTCGAGTATGCCTAGTACAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-240s1c1
Sequence:CCGGCCTATGATGATTTCAACACAACTCGAGTTGTGTTGAAATCATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-1748s1c1
Sequence:CCGGCGGATGACTGTTTCTCTTGTTCTCGAGAACAAGAGAAACAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-437s1c1
Sequence:CCGGGCTCACTGGATGACAGACTTACTCGAGTAAGTCTGTCATCCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-658s1c1
Sequence:CCGGCCTTGCTGTATCTCTTGTCAACTCGAGTTGACAAGAGATACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-658s21c1
Sequence:CCGGCCTTGCTGTATCTCTTGTCAACTCGAGTTGACAAGAGATACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-1748s21c1
Sequence:CCGGCGGATGACTGTTTCTCTTGTTCTCGAGAACAAGAGAAACAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-240s21c1
Sequence:CCGGCCTATGATGATTTCAACACAACTCGAGTTGTGTTGAAATCATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-1163s21c1
Sequence:CCGGCCATTCATTGTACTAGGCATACTCGAGTATGCCTAGTACAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016691
VALIDATED
CLCN5 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-1163s1c1
Sequence:CCGGCCATTCATTGTACTAGGCATACTCGAGTATGCCTAGTACAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-240s1c1
Sequence:CCGGCCTATGATGATTTCAACACAACTCGAGTTGTGTTGAAATCATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-1748s1c1
Sequence:CCGGCGGATGACTGTTTCTCTTGTTCTCGAGAACAAGAGAAACAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-437s1c1
Sequence:CCGGGCTCACTGGATGACAGACTTACTCGAGTAAGTCTGTCATCCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016691.2-658s1c1
Sequence:CCGGCCTTGCTGTATCTCTTGTCAACTCGAGTTGACAAGAGATACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-658s21c1
Sequence:CCGGCCTTGCTGTATCTCTTGTCAACTCGAGTTGACAAGAGATACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-1748s21c1
Sequence:CCGGCGGATGACTGTTTCTCTTGTTCTCGAGAACAAGAGAAACAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-240s21c1
Sequence:CCGGCCTATGATGATTTCAACACAACTCGAGTTGTGTTGAAATCATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016691.2-1163s21c1
Sequence:CCGGCCATTCATTGTACTAGGCATACTCGAGTATGCCTAGTACAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000084
CLCN5 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-2005s1c1
Sequence:CCGGGCCAAAGAAGAGTTTGCTCATCTCGAGATGAGCAAACTCTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-582s1c1
Sequence:CCGGCCATGAACATTGTTGCTGGAACTCGAGTTCCAGCAACAATGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-1036s1c1
Sequence:CCGGGCTGGTGTATCTGTAGCCTTTCTCGAGAAAGGCTACAGATACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-387s1c1
Sequence:CCGGGCACCGAGAGATTACCAATAACTCGAGTTATTGGTAATCTCTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-1585s1c1
Sequence:CCGGGCTTTAACACTCATACTGAAACTCGAGTTTCAGTATGAGTGTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000084.2-1018s21c1
Sequence:CCGGCACCTATAGGTGGAGTATTATCTCGAGATAATACTCCACCTATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000084.2-1212s21c1
Sequence:CCGGTTCATTCTGCTGGGCATATTTCTCGAGAAATATGCCCAGCAGAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000084
CLCN5 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-2005s1c1
Sequence:CCGGGCCAAAGAAGAGTTTGCTCATCTCGAGATGAGCAAACTCTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-582s1c1
Sequence:CCGGCCATGAACATTGTTGCTGGAACTCGAGTTCCAGCAACAATGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-1036s1c1
Sequence:CCGGGCTGGTGTATCTGTAGCCTTTCTCGAGAAAGGCTACAGATACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-387s1c1
Sequence:CCGGGCACCGAGAGATTACCAATAACTCGAGTTATTGGTAATCTCTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-1585s1c1
Sequence:CCGGGCTTTAACACTCATACTGAAACTCGAGTTTCAGTATGAGTGTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000084.2-1018s21c1
Sequence:CCGGCACCTATAGGTGGAGTATTATCTCGAGATAATACTCCACCTATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000084.2-1212s21c1
Sequence:CCGGTTCATTCTGCTGGGCATATTTCTCGAGAAATATGCCCAGCAGAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000084
CLCN5 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-2005s1c1
Sequence:CCGGGCCAAAGAAGAGTTTGCTCATCTCGAGATGAGCAAACTCTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-582s1c1
Sequence:CCGGCCATGAACATTGTTGCTGGAACTCGAGTTCCAGCAACAATGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-1036s1c1
Sequence:CCGGGCTGGTGTATCTGTAGCCTTTCTCGAGAAAGGCTACAGATACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-387s1c1
Sequence:CCGGGCACCGAGAGATTACCAATAACTCGAGTTATTGGTAATCTCTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000084.1-1585s1c1
Sequence:CCGGGCTTTAACACTCATACTGAAACTCGAGTTTCAGTATGAGTGTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000084.2-1018s21c1
Sequence:CCGGCACCTATAGGTGGAGTATTATCTCGAGATAATACTCCACCTATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000084.2-1212s21c1
Sequence:CCGGTTCATTCTGCTGGGCATATTTCTCGAGAAATATGCCCAGCAGAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks