EMAIL THIS PAGE TO A FRIEND

CLCN6

chloride channel, voltage-sensitive 6

169 Gene Product Result for
Synonyms: CLC-6
Gene ID:
Human(1185) Summary: This gene encodes a member of the voltage-dependent chloride channel protein family. Members of this family can function as either chloride channels or antiporters. This protein is primarily localized to late endosomes and functions as a chloride/proton antiporter. Alternate splicing results in both coding and non-coding variants. Additional alternately spliced variants have been described but their full-length structure is unknown. [provided by RefSeq, Mar 2012]
Mouse(26372) chloride channel 6
Rat(295586) chloride channel, voltage-sensitive 6
Zebrafish(568122) chloride channel 6
cow(520210) chloride channel 6
Horse(100056209) chloride channel, voltage-sensitive 6
domestic cat(101100142) chloride channel, voltage-sensitive 6
dog(478229) chloride channel, voltage-sensitive 6
chicken(419488) chloride channel, voltage-sensitive 6
domestic guinea pig(100715142) chloride channel, voltage-sensitive 6
naked mole-rat(101718768) chloride channel, voltage-sensitive 6
sheep(101111209) chloride channel, voltage-sensitive 6
Domestic Rabbit(100008750) chloride channel, voltage-sensitive 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001286 Rosetta Predictions human pricing
NM_021735 Rosetta Predictions human pricing
NM_021736 Rosetta Predictions human pricing
NM_021737 Rosetta Predictions human pricing
NM_001106479 Rosetta Predictions rat pricing
NM_011929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331534 predicted 461
2 SASI_Hs02_00331535 predicted 577
3 SASI_Hs02_00331536 predicted 389
4 SASI_Hs01_00144962 predicted 569
5 SASI_Hs02_00331537 predicted 585
6 SASI_Hs02_00331538 predicted 377
7 SASI_Hs02_00331539 predicted 470
8 SASI_Hs02_00331540 predicted 394
9 SASI_Hs01_00144968 predicted 412
10 SASI_Hs02_00331541 predicted 413
11 SASI_Hs01_00144959 predicted 2925
12 SASI_Hs01_00144960 predicted 3066
13 SASI_Hs01_00144961 predicted 3064
14 SASI_Hs01_00144963 predicted 3080
15 SASI_Hs01_00144964 predicted 3009
16 SASI_Hs01_00144965 predicted 3134
17 SASI_Hs01_00144966 predicted 2841
18 SASI_Hs01_00144967 predicted 3067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355062 predicted 461
2 SASI_Hs02_00355063 predicted 582
3 SASI_Hs02_00355064 predicted 392
4 SASI_Hs01_00231563 predicted 571
5 SASI_Hs02_00355065 predicted 578
6 SASI_Hs02_00355066 predicted 377
7 SASI_Hs02_00355067 predicted 473
8 SASI_Hs02_00355068 predicted 389
9 SASI_Hs01_00231569 predicted 414
10 SASI_Hs02_00355069 predicted 413
11 SASI_Hs01_00231560 predicted 1277
12 SASI_Hs01_00231561 predicted 1414
13 SASI_Hs01_00231562 predicted 1422
14 SASI_Hs01_00231564 predicted 1428
15 SASI_Hs01_00231565 predicted 1359
16 SASI_Hs01_00231566 predicted 1489
17 SASI_Hs01_00231567 predicted 1200
18 SASI_Hs01_00231568 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355070 predicted 459
2 SASI_Hs02_00355071 predicted 581
3 SASI_Hs02_00355072 predicted 392
4 SASI_Hs01_00239029 predicted 570
5 SASI_Hs02_00355073 predicted 580
6 SASI_Hs02_00355074 predicted 375
7 SASI_Hs02_00355075 predicted 470
8 SASI_Hs02_00355076 predicted 394
9 SASI_Hs01_00239035 predicted 412
10 SASI_Hs02_00355077 predicted 413
11 SASI_Hs01_00239026 predicted 1373
12 SASI_Hs01_00239027 predicted 1513
13 SASI_Hs01_00239028 predicted 1523
14 SASI_Hs01_00239030 predicted 1526
15 SASI_Hs01_00239031 predicted 1466
16 SASI_Hs01_00239032 predicted 1587
17 SASI_Hs01_00239033 predicted 1296
18 SASI_Hs01_00239034 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355078 predicted 454
2 SASI_Hs02_00355079 predicted 581
3 SASI_Hs02_00355080 predicted 390
4 SASI_Hs01_00030592 predicted 569
5 SASI_Hs02_00355081 predicted 576
6 SASI_Hs02_00355082 predicted 378
7 SASI_Hs02_00355083 predicted 468
8 SASI_Hs02_00355084 predicted 394
9 SASI_Hs01_00030598 predicted 411
10 SASI_Hs02_00355085 predicted 416
11 SASI_Hs01_00030589 predicted 1236
12 SASI_Hs01_00030590 predicted 1385
13 SASI_Hs01_00030591 predicted 1387
14 SASI_Hs01_00030593 predicted 1392
15 SASI_Hs01_00030594 predicted 1325
16 SASI_Hs01_00030595 predicted 1445
17 SASI_Hs01_00030596 predicted 1162
18 SASI_Hs01_00030597 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219368 predicted 1979
2 SASI_Rn02_00219369 predicted 514
3 SASI_Rn02_00219370 predicted 1934
4 SASI_Rn02_00219371 predicted 1854
5 SASI_Rn02_00219372 predicted 1672
6 SASI_Rn02_00219373 predicted 540
7 SASI_Rn02_00219374 predicted 503
8 SASI_Rn02_00219375 predicted 1289
9 SASI_Rn02_00219376 predicted 1529
10 SASI_Rn02_00219377 predicted 1660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321760 predicted 1721
2 SASI_Mm01_00024176 predicted 306
3 SASI_Mm01_00024177 predicted 2462
4 SASI_Mm01_00024178 predicted 1702
5 SASI_Mm02_00321761 predicted 1393
6 SASI_Mm01_00024179 predicted 1546
7 SASI_Mm01_00024180 predicted 497
8 SASI_Mm01_00024182 predicted 987
9 SASI_Mm01_00024183 predicted 1494
10 SASI_Mm01_00024184 predicted 1099
11 SASI_Mm01_00024181 predicted 1722
12 SASI_Mm01_00024185 predicted 1642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001286
VALIDATED
CLCN6 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001286.2-602s21c1
Sequence:CCGGATGCTATCTGAATGGCGTAAACTCGAGTTTACGCCATTCAGATAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001286.2-1541s21c1
Sequence:CCGGATGTTGGACTTACGGCATTTCCTCGAGGAAATGCCGTAAGTCCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-959s1c1
Sequence:CCGGGCTGAACTTTGGCGAGTTTAACTCGAGTTAAACTCGCCAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-2291s1c1
Sequence:CCGGCCGAGGAGTTTGTTACTCTGACTCGAGTCAGAGTAACAAACTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-1134s1c1
Sequence:CCGGCCTAAGCTCGTCAGAGTCTTACTCGAGTAAGACTCTGACGAGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001286.1-1946s1c1
Sequence:CCGGCGGTAACGAGAAGGAGTTCATCTCGAGATGAACTCCTTCTCGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-175s1c1
Sequence:CCGGGTTTGGATTATGATCGCTGTACTCGAGTACAGCGATCATAATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001286
VALIDATED
CLCN6 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001286.2-602s21c1
Sequence:CCGGATGCTATCTGAATGGCGTAAACTCGAGTTTACGCCATTCAGATAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001286.2-1541s21c1
Sequence:CCGGATGTTGGACTTACGGCATTTCCTCGAGGAAATGCCGTAAGTCCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-959s1c1
Sequence:CCGGGCTGAACTTTGGCGAGTTTAACTCGAGTTAAACTCGCCAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-2291s1c1
Sequence:CCGGCCGAGGAGTTTGTTACTCTGACTCGAGTCAGAGTAACAAACTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-1134s1c1
Sequence:CCGGCCTAAGCTCGTCAGAGTCTTACTCGAGTAAGACTCTGACGAGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001286.1-1946s1c1
Sequence:CCGGCGGTAACGAGAAGGAGTTCATCTCGAGATGAACTCCTTCTCGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-175s1c1
Sequence:CCGGGTTTGGATTATGATCGCTGTACTCGAGTACAGCGATCATAATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001286
VALIDATED
CLCN6 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001286.2-602s21c1
Sequence:CCGGATGCTATCTGAATGGCGTAAACTCGAGTTTACGCCATTCAGATAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001286.2-1541s21c1
Sequence:CCGGATGTTGGACTTACGGCATTTCCTCGAGGAAATGCCGTAAGTCCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-959s1c1
Sequence:CCGGGCTGAACTTTGGCGAGTTTAACTCGAGTTAAACTCGCCAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-2291s1c1
Sequence:CCGGCCGAGGAGTTTGTTACTCTGACTCGAGTCAGAGTAACAAACTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-1134s1c1
Sequence:CCGGCCTAAGCTCGTCAGAGTCTTACTCGAGTAAGACTCTGACGAGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001286.1-1946s1c1
Sequence:CCGGCGGTAACGAGAAGGAGTTCATCTCGAGATGAACTCCTTCTCGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001286.1-175s1c1
Sequence:CCGGGTTTGGATTATGATCGCTGTACTCGAGTACAGCGATCATAATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011929
CLCN6 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011929.2-1723s21c1
Sequence:CCGGGGCATTTATGACGTCCATATTCTCGAGAATATGGACGTCATAAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011929.2-192s21c1
Sequence:CCGGGTTGGAGACCATGGATAATAACTCGAGTTATTATCCATGGTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-933s1c1
Sequence:CCGGGCTGAACTTTGGCGAATTTAACTCGAGTTAAATTCGCCAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011929.1-2716s1c1
Sequence:CCGGCCGTTTGCTCAGATGCCTGGACTCGAGTCCAGGCATCTGAGCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-162s1c1
Sequence:CCGGCCGCTGCATCAATGACCCTTACTCGAGTAAGGGTCATTGATGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-430s1c1
Sequence:CCGGGCAAGCCTTCTTGTCTTGATACTCGAGTATCAAGACAAGAAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-2551s1c1
Sequence:CCGGCGGCACAACCTGACAAATGAACTCGAGTTCATTTGTCAGGTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011929
CLCN6 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011929.2-1723s21c1
Sequence:CCGGGGCATTTATGACGTCCATATTCTCGAGAATATGGACGTCATAAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011929.2-192s21c1
Sequence:CCGGGTTGGAGACCATGGATAATAACTCGAGTTATTATCCATGGTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-933s1c1
Sequence:CCGGGCTGAACTTTGGCGAATTTAACTCGAGTTAAATTCGCCAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011929.1-2716s1c1
Sequence:CCGGCCGTTTGCTCAGATGCCTGGACTCGAGTCCAGGCATCTGAGCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-162s1c1
Sequence:CCGGCCGCTGCATCAATGACCCTTACTCGAGTAAGGGTCATTGATGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-430s1c1
Sequence:CCGGGCAAGCCTTCTTGTCTTGATACTCGAGTATCAAGACAAGAAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-2551s1c1
Sequence:CCGGCGGCACAACCTGACAAATGAACTCGAGTTCATTTGTCAGGTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011929
CLCN6 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011929.2-1723s21c1
Sequence:CCGGGGCATTTATGACGTCCATATTCTCGAGAATATGGACGTCATAAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011929.2-192s21c1
Sequence:CCGGGTTGGAGACCATGGATAATAACTCGAGTTATTATCCATGGTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-933s1c1
Sequence:CCGGGCTGAACTTTGGCGAATTTAACTCGAGTTAAATTCGCCAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011929.1-2716s1c1
Sequence:CCGGCCGTTTGCTCAGATGCCTGGACTCGAGTCCAGGCATCTGAGCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-162s1c1
Sequence:CCGGCCGCTGCATCAATGACCCTTACTCGAGTAAGGGTCATTGATGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-430s1c1
Sequence:CCGGGCAAGCCTTCTTGTCTTGATACTCGAGTATCAAGACAAGAAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011929.1-2551s1c1
Sequence:CCGGCGGCACAACCTGACAAATGAACTCGAGTTCATTTGTCAGGTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks