EMAIL THIS PAGE TO A FRIEND

CLCN7

chloride channel, voltage-sensitive 7

66 Gene Product Result for
Synonyms: CLC-7 CLC7 OPTA2 OPTB4 PPP1R63
Gene ID:
Human(1186) Summary: The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
Mouse(26373) chloride channel 7
Rat(29233) chloride channel, voltage-sensitive 7
Goat(100861025) chloride channel, voltage-sensitive 7
Domestic Rabbit(100009007) chloride channel, voltage-sensitive 7
sheep(101107658) chloride channel, voltage-sensitive 7
naked mole-rat(101720575) chloride channel, voltage-sensitive 7
domestic guinea pig(100723969) chloride channel, voltage-sensitive 7
Zebrafish(553351) chloride channel 7
chicken(416656) chloride channel, voltage-sensitive 7
cow(513545) chloride channel 7
domestic cat(101085517) chloride channel, voltage-sensitive 7
dog(479889) chloride channel, voltage-sensitive 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001287 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114331 Rosetta Predictions human pricing
NM_001287 Rosetta Predictions human pricing
NM_031568 Rosetta Predictions rat pricing
NM_011930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326514 predicted 652
2 SASI_Hs02_00326515 predicted 2360
3 SASI_Hs02_00326516 predicted 846
4 SASI_Hs02_00326517 predicted 698
5 SASI_Hs02_00326518 predicted 2111
6 SASI_Hs02_00326519 predicted 1710
7 SASI_Hs02_00326520 predicted 1950
8 SASI_Hs02_00326521 predicted 771
9 SASI_Hs02_00326522 predicted 1208
10 SASI_Hs02_00326523 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069653 predicted 723
2 SASI_Hs01_00069654 predicted 2431
3 SASI_Hs02_00331542 predicted 915
4 SASI_Hs01_00069656 predicted 772
5 SASI_Hs01_00069657 predicted 2177
6 SASI_Hs01_00069658 predicted 1780
7 SASI_Hs01_00069660 predicted 2023
8 SASI_Hs02_00331543 predicted 836
9 SASI_Hs02_00331544 predicted 1271
10 SASI_Hs02_00331545 predicted 873
11 SASI_Hs01_00069652 predicted 1237
12 SASI_Hs01_00069655 predicted 882
13 SASI_Hs01_00069659 predicted 409
14 SASI_Hs01_00069661 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264810 predicted 1170
2 SASI_Rn01_00113031 predicted 1987
3 SASI_Rn01_00113032 predicted 2127
4 SASI_Rn01_00113033 predicted 1255
5 SASI_Rn01_00113034 predicted 1338
6 SASI_Rn01_00113035 predicted 472
7 SASI_Rn01_00113036 predicted 2006
8 SASI_Rn01_00113037 predicted 825
9 SASI_Rn01_00113038 predicted 1821
10 SASI_Rn01_00113039 predicted 806
11 SASI_Rn01_00113040 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182138 predicted 1841
2 SASI_Mm01_00182139 predicted 812
3 SASI_Mm01_00182140 predicted 2010
4 SASI_Mm02_00321762 predicted 494
5 SASI_Mm01_00182141 predicted 2230
6 SASI_Mm01_00182142 predicted 485
7 SASI_Mm01_00182143 predicted 837
8 SASI_Mm01_00182144 predicted 352
9 SASI_Mm01_00182145 predicted 2038
10 SASI_Mm01_00182146 predicted 867
11 SASI_Mm01_00182137 predicted 2443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011930
VALIDATED
CLCN7 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011930.2-2738s1c1
Sequence:CCGGCCCAGGATGAAGTGTGTGTTACTCGAGTAACACACACTTCATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011930.2-1846s1c1
Sequence:CCGGGCCAAGATTGTGGGTGATGTTCTCGAGAACATCACCCACAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011930.2-219s1c1
Sequence:CCGGCCAGTCTCATTCTGCACTGTTCTCGAGAACAGTGCAGAATGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011930.2-1183s1c1
Sequence:CCGGGCCTACACCATCCATGAGATTCTCGAGAATCTCATGGATGGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011930.2-499s1c1
Sequence:CCGGGCCTGCTTCATTGACATTGTACTCGAGTACAATGTCAATGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011930.3-1182s21c1
Sequence:CCGGGCCTACACCATCCATGAGATTCTCGAGAATCTCATGGATGGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011930.3-2811s21c1
Sequence:CCGGCAGACGTGAGCTACTACTTACCTCGAGGTAAGTAGTAGCTCACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011930.3-2028s21c1
Sequence:CCGGCTAAGCGACACAGCGTCTAATCTCGAGATTAGACGCTGTGTCGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011930.3-1515s21c1
Sequence:CCGGGACCCACCAGGCTCCTATAATCTCGAGATTATAGGAGCCTGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011930.3-1697s21c1
Sequence:CCGGCTGGGCAGATCCGGGTAAATACTCGAGTATTTACCCGGATCTGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011930
VALIDATED
CLCN7 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011930.2-2738s1c1
Sequence:CCGGCCCAGGATGAAGTGTGTGTTACTCGAGTAACACACACTTCATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011930.2-1846s1c1
Sequence:CCGGGCCAAGATTGTGGGTGATGTTCTCGAGAACATCACCCACAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011930.2-219s1c1
Sequence:CCGGCCAGTCTCATTCTGCACTGTTCTCGAGAACAGTGCAGAATGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011930.2-1183s1c1
Sequence:CCGGGCCTACACCATCCATGAGATTCTCGAGAATCTCATGGATGGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011930.2-499s1c1
Sequence:CCGGGCCTGCTTCATTGACATTGTACTCGAGTACAATGTCAATGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011930.3-1182s21c1
Sequence:CCGGGCCTACACCATCCATGAGATTCTCGAGAATCTCATGGATGGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011930.3-2811s21c1
Sequence:CCGGCAGACGTGAGCTACTACTTACCTCGAGGTAAGTAGTAGCTCACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011930.3-2028s21c1
Sequence:CCGGCTAAGCGACACAGCGTCTAATCTCGAGATTAGACGCTGTGTCGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011930.3-1515s21c1
Sequence:CCGGGACCCACCAGGCTCCTATAATCTCGAGATTATAGGAGCCTGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011930.3-1697s21c1
Sequence:CCGGCTGGGCAGATCCGGGTAAATACTCGAGTATTTACCCGGATCTGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011930
VALIDATED
CLCN7 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011930.2-2738s1c1
Sequence:CCGGCCCAGGATGAAGTGTGTGTTACTCGAGTAACACACACTTCATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011930.2-1846s1c1
Sequence:CCGGGCCAAGATTGTGGGTGATGTTCTCGAGAACATCACCCACAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011930.2-219s1c1
Sequence:CCGGCCAGTCTCATTCTGCACTGTTCTCGAGAACAGTGCAGAATGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011930.2-1183s1c1
Sequence:CCGGGCCTACACCATCCATGAGATTCTCGAGAATCTCATGGATGGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011930.2-499s1c1
Sequence:CCGGGCCTGCTTCATTGACATTGTACTCGAGTACAATGTCAATGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011930.3-1182s21c1
Sequence:CCGGGCCTACACCATCCATGAGATTCTCGAGAATCTCATGGATGGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011930.3-2811s21c1
Sequence:CCGGCAGACGTGAGCTACTACTTACCTCGAGGTAAGTAGTAGCTCACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011930.3-2028s21c1
Sequence:CCGGCTAAGCGACACAGCGTCTAATCTCGAGATTAGACGCTGTGTCGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011930.3-1515s21c1
Sequence:CCGGGACCCACCAGGCTCCTATAATCTCGAGATTATAGGAGCCTGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011930.3-1697s21c1
Sequence:CCGGCTGGGCAGATCCGGGTAAATACTCGAGTATTTACCCGGATCTGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001287
VALIDATED
CLCN7 MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001287.3-496s1c1
Sequence:CCGGCCTCAAGTACAGGGTCATCAACTCGAGTTGATGACCCTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001287.3-1036s1c1
Sequence:CCGGCTCCACGTTCACCCTGAATTTCTCGAGAAATTCAGGGTGAACGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001287.3-514s1c1
Sequence:CCGGCAAGGGCAATATCGACAAGTTCTCGAGAACTTGTCGATATTGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001287.3-2083s1c1
Sequence:CCGGCCAGCTCATCGTTCTCCTAAACTCGAGTTTAGGAGAACGATGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001287.3-1105s1c1
Sequence:CCGGCCTCATCAACTTCGGAAGGTTCTCGAGAACCTTCCGAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-2763s21c1
Sequence:CCGGCTCCTCGTCTAGGTTTCTTTACTCGAGTAAAGAAACCTAGACGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-1109s21c1
Sequence:CCGGCTCCACGTTCACCCTGAATTTCTCGAGAAATTCAGGGTGAACGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-388s21c1
Sequence:CCGGAGTATGAGAGCTTGGACTATGCTCGAGCATAGTCCAAGCTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-781s21c1
Sequence:CCGGTCAAGACGTTGGTGATCAAAGCTCGAGCTTTGATCACCAACGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-909s21c1
Sequence:CCGGACGTCACTGAAACGAGATTTCCTCGAGGAAATCTCGTTTCAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001287
VALIDATED
CLCN7 MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001287.3-496s1c1
Sequence:CCGGCCTCAAGTACAGGGTCATCAACTCGAGTTGATGACCCTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001287.3-1036s1c1
Sequence:CCGGCTCCACGTTCACCCTGAATTTCTCGAGAAATTCAGGGTGAACGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001287.3-514s1c1
Sequence:CCGGCAAGGGCAATATCGACAAGTTCTCGAGAACTTGTCGATATTGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001287.3-2083s1c1
Sequence:CCGGCCAGCTCATCGTTCTCCTAAACTCGAGTTTAGGAGAACGATGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001287.3-1105s1c1
Sequence:CCGGCCTCATCAACTTCGGAAGGTTCTCGAGAACCTTCCGAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-2763s21c1
Sequence:CCGGCTCCTCGTCTAGGTTTCTTTACTCGAGTAAAGAAACCTAGACGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-1109s21c1
Sequence:CCGGCTCCACGTTCACCCTGAATTTCTCGAGAAATTCAGGGTGAACGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-388s21c1
Sequence:CCGGAGTATGAGAGCTTGGACTATGCTCGAGCATAGTCCAAGCTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-781s21c1
Sequence:CCGGTCAAGACGTTGGTGATCAAAGCTCGAGCTTTGATCACCAACGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-909s21c1
Sequence:CCGGACGTCACTGAAACGAGATTTCCTCGAGGAAATCTCGTTTCAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001287
VALIDATED
CLCN7 MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001287.3-496s1c1
Sequence:CCGGCCTCAAGTACAGGGTCATCAACTCGAGTTGATGACCCTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001287.3-1036s1c1
Sequence:CCGGCTCCACGTTCACCCTGAATTTCTCGAGAAATTCAGGGTGAACGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001287.3-514s1c1
Sequence:CCGGCAAGGGCAATATCGACAAGTTCTCGAGAACTTGTCGATATTGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001287.3-2083s1c1
Sequence:CCGGCCAGCTCATCGTTCTCCTAAACTCGAGTTTAGGAGAACGATGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001287.3-1105s1c1
Sequence:CCGGCCTCATCAACTTCGGAAGGTTCTCGAGAACCTTCCGAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-2763s21c1
Sequence:CCGGCTCCTCGTCTAGGTTTCTTTACTCGAGTAAAGAAACCTAGACGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-1109s21c1
Sequence:CCGGCTCCACGTTCACCCTGAATTTCTCGAGAAATTCAGGGTGAACGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-388s21c1
Sequence:CCGGAGTATGAGAGCTTGGACTATGCTCGAGCATAGTCCAAGCTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-781s21c1
Sequence:CCGGTCAAGACGTTGGTGATCAAAGCTCGAGCTTTGATCACCAACGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001287.4-909s21c1
Sequence:CCGGACGTCACTGAAACGAGATTTCCTCGAGGAAATCTCGTTTCAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks