EMAIL THIS PAGE TO A FRIEND

CLCNKA

chloride channel, voltage-sensitive Ka

75 Gene Product Result for
Synonyms: CLCK1 ClC-K1 hClC-Ka
Gene ID:
Human(1187) Summary: This gene is a member of the CLC family of voltage-gated chloride channels. The encoded protein is predicted to have 12 transmembrane domains, and requires a beta subunit called barttin to form a functional channel. It is thought to function in salt reabsorption in the kidney and potassium recycling in the inner ear. The gene is highly similar to CLCNKB, which is located 10 kb downstream from this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12733) chloride channel Ka
Rat(79425) chloride channel, voltage-sensitive Ka
sheep(101111082) chloride channel, voltage-sensitive Ka
Domestic Rabbit(100009213) chloride channel, voltage-sensitive Ka
naked mole-rat(101713590) chloride channel, voltage-sensitive Ka
cow(538145) chloride channel Ka
domestic cat(101084978) chloride channel, voltage-sensitive Ka
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004070 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126981 MISSION® esiRNA esiRNA human CLCNKA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042704 Rosetta Predictions human pricing
NM_004070 Rosetta Predictions human pricing
NM_053327 Rosetta Predictions rat pricing
NM_024412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311045 predicted 1537
2 SASI_Hs02_00311046 predicted 1034
3 SASI_Hs02_00311047 predicted 590
4 SASI_Hs02_00311048 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171573 predicted 1536
2 SASI_Hs01_00171575 predicted 1037
3 SASI_Hs01_00171576 predicted 597
4 SASI_Hs02_00336863 predicted 266
5 SASI_Hs01_00171574 predicted 310
6 SASI_Hs01_00171577 predicted 636
7 SASI_Hs01_00171578 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265761 predicted 610
2 SASI_Rn01_00077746 predicted 1313
3 SASI_Rn01_00077747 predicted 1505
4 SASI_Rn01_00077748 predicted 518
5 SASI_Rn01_00077749 predicted 1107
6 SASI_Rn01_00077750 predicted 1141
7 SASI_Rn01_00077751 predicted 1276
8 SASI_Rn01_00077752 predicted 1981
9 SASI_Rn02_00265762 predicted 1886
10 SASI_Rn01_00077754 predicted 995
11 SASI_Rn01_00077745 predicted 1775
12 SASI_Rn01_00077753 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124547 predicted 2079
2 SASI_Mm01_00124548 predicted 2075
3 SASI_Mm01_00124550 predicted 1785
4 SASI_Mm01_00124551 predicted 1324
5 SASI_Mm01_00124552 predicted 1515
6 SASI_Mm01_00124553 predicted 876
7 SASI_Mm02_00327723 predicted 1687
8 SASI_Mm01_00124554 predicted 939
9 SASI_Mm01_00124555 predicted 1684
10 SASI_Mm02_00327724 predicted 950
11 SASI_Mm01_00124549 predicted 245
12 SASI_Mm01_00124556 predicted 1294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004070
CLCNKA MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive Ka
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-2031s1c1
Sequence:CCGGGCAATTTCCAACCTGACAAATCTCGAGATTTGTCAGGTTGGAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-197s1c1
Sequence:CCGGCTATGCCATAAACTTTGCCATCTCGAGATGGCAAAGTTTATGGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-929s1c1
Sequence:CCGGCTTCATCAAGACCAATCGGTTCTCGAGAACCGATTGGTCTTGATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-188s1c1
Sequence:CCGGCCTGGTCAGCTATGCCATAAACTCGAGTTTATGGCATAGCTGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-1287s1c1
Sequence:CCGGCCCATCTTTATCCTTGGAGCTCTCGAGAGCTCCAAGGATAAAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004070
CLCNKA MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive Ka
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-2031s1c1
Sequence:CCGGGCAATTTCCAACCTGACAAATCTCGAGATTTGTCAGGTTGGAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-197s1c1
Sequence:CCGGCTATGCCATAAACTTTGCCATCTCGAGATGGCAAAGTTTATGGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-929s1c1
Sequence:CCGGCTTCATCAAGACCAATCGGTTCTCGAGAACCGATTGGTCTTGATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-188s1c1
Sequence:CCGGCCTGGTCAGCTATGCCATAAACTCGAGTTTATGGCATAGCTGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-1287s1c1
Sequence:CCGGCCCATCTTTATCCTTGGAGCTCTCGAGAGCTCCAAGGATAAAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004070
CLCNKA MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive Ka
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-2031s1c1
Sequence:CCGGGCAATTTCCAACCTGACAAATCTCGAGATTTGTCAGGTTGGAAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-197s1c1
Sequence:CCGGCTATGCCATAAACTTTGCCATCTCGAGATGGCAAAGTTTATGGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-929s1c1
Sequence:CCGGCTTCATCAAGACCAATCGGTTCTCGAGAACCGATTGGTCTTGATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-188s1c1
Sequence:CCGGCCTGGTCAGCTATGCCATAAACTCGAGTTTATGGCATAGCTGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004070.2-1287s1c1
Sequence:CCGGCCCATCTTTATCCTTGGAGCTCTCGAGAGCTCCAAGGATAAAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024412
CLCNKA MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive Ka
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-251s1c1
Sequence:CCGGCTATGCCATGAACTTTGCTATCTCGAGATAGCAAAGTTCATGGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-978s1c1
Sequence:CCGGCTCCGTTTCATCAAGACCAATCTCGAGATTGGTCTTGATGAAACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-1326s1c1
Sequence:CCGGGCTGGCTACTTCATGCCTATACTCGAGTATAGGCATGAAGTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-1696s1c1
Sequence:CCGGCGGTGGAACATTTCATGAATTCTCGAGAATTCATGAAATGTTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-893s1c1
Sequence:CCGGCCTGCCTGAAATCTTCTTCTTCTCGAGAAGAAGAAGATTTCAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024412
CLCNKA MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive Ka
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-251s1c1
Sequence:CCGGCTATGCCATGAACTTTGCTATCTCGAGATAGCAAAGTTCATGGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-978s1c1
Sequence:CCGGCTCCGTTTCATCAAGACCAATCTCGAGATTGGTCTTGATGAAACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-1326s1c1
Sequence:CCGGGCTGGCTACTTCATGCCTATACTCGAGTATAGGCATGAAGTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-1696s1c1
Sequence:CCGGCGGTGGAACATTTCATGAATTCTCGAGAATTCATGAAATGTTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-893s1c1
Sequence:CCGGCCTGCCTGAAATCTTCTTCTTCTCGAGAAGAAGAAGATTTCAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024412
CLCNKA MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive Ka
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-251s1c1
Sequence:CCGGCTATGCCATGAACTTTGCTATCTCGAGATAGCAAAGTTCATGGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-978s1c1
Sequence:CCGGCTCCGTTTCATCAAGACCAATCTCGAGATTGGTCTTGATGAAACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-1326s1c1
Sequence:CCGGGCTGGCTACTTCATGCCTATACTCGAGTATAGGCATGAAGTAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-1696s1c1
Sequence:CCGGCGGTGGAACATTTCATGAATTCTCGAGAATTCATGAAATGTTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024412.2-893s1c1
Sequence:CCGGCCTGCCTGAAATCTTCTTCTTCTCGAGAAGAAGAAGATTTCAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)