EMAIL THIS PAGE TO A FRIEND

CLCNKB

chloride channel, voltage-sensitive Kb

47 Gene Product Result for
Synonyms: CLCKB ClC-K2 ClC-Kb
UniProtKB ID: P51801, B3KUY3, Q5T5Q7, Q5T5Q8
Gene ID:
Human(1188) Summary: The protein encoded by this gene is a member of the family of voltage-gated chloride channels. Chloride channels have several functions, including the regulation of cell volume, membrane potential stabilization, signal transduction and transepithelial transport. This gene is expressed predominantly in the kidney and may be important for renal salt reabsorption. Mutations in this gene are associated with autosomal recessive Bartter syndrome type 3 (BS3). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(56365) chloride channel Kb
Rat(79430) chloride channel, voltage-sensitive Kb
chicken(428190) chloride channel, voltage-sensitive Kb
dog(487422) chloride channel, voltage-sensitive Kb
domestic guinea pig(100730738) chloride channel, voltage-sensitive Kb
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C7597 Anti-Chloride Channel-K (CLC-K) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat
immunohistochemistry, immunoprecipitation, western blot pricing
HPA057717 Anti-CLCNKA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV34917 Anti-CLCNKB (AB1) antibody produced in rabbit affinity isolated antibody canine, guinea pig, rabbit, human, horse, mouse, rat, bovine, rabbit
western blot pricing
AV34916 Anti-CLCNKB (AB2) antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, human, canine, mouse, rabbit, rat
immunohistochemistry, western blot pricing
SAB2107921 Anti-CLCNKB antibody produced in rabbit affinity isolated antibody mouse, rabbit, horse, bovine, human, canine, rat, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000085 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000085 Rosetta Predictions human pricing
NM_173103 Rosetta Predictions rat pricing
NM_019701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224768 predicted 649
2 SASI_Hs01_00224771 predicted 1045
3 SASI_Hs01_00224773 predicted 2082
4 SASI_Hs01_00224769 predicted 342
5 SASI_Hs01_00224770 predicted 668
6 SASI_Hs01_00224772 predicted 670
7 SASI_Hs01_00224774 predicted 1970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051013 predicted 586
2 SASI_Rn01_00051014 predicted 897
3 SASI_Rn01_00051015 predicted 2045
4 SASI_Rn01_00051016 predicted 1205
5 SASI_Rn01_00051017 predicted 1085
6 SASI_Rn01_00051018 predicted 1906
7 SASI_Rn01_00051019 predicted 832
8 SASI_Rn01_00051020 predicted 1079
9 SASI_Rn01_00051021 predicted 605
10 SASI_Rn01_00051022 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324801 predicted 1235
2 SASI_Mm02_00324802 predicted 846
3 SASI_Mm01_00057795 predicted 1661
4 SASI_Mm02_00324803 predicted 1238
5 SASI_Mm01_00057796 predicted 1670
6 SASI_Mm02_00324804 predicted 1229
7 SASI_Mm01_00057798 predicted 865
8 SASI_Mm01_00057800 predicted 1680
9 SASI_Mm01_00057799 predicted 1343
10 SASI_Mm01_00057803 predicted 1317
11 SASI_Mm01_00057794 predicted 219
12 SASI_Mm01_00057797 predicted 1308
13 SASI_Mm01_00057801 predicted 621
14 SASI_Mm01_00057802 predicted 1499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019701
CLCNKB MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive Kb
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-233s1c1
Sequence:CCGGCTATGCTATGAACTTCACTATCTCGAGATAGTGAAGTTCATAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-798s1c1
Sequence:CCGGCTGGCGGTCTTCAACAATGAACTCGAGTTCATTGTTGAAGACCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-1893s1c1
Sequence:CCGGCTCCAGGATATCTTGGCTAATCTCGAGATTAGCCAAGATATCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-623s1c1
Sequence:CCGGGACCAAAGAAATGGAACTGTTCTCGAGAACAGTTCCATTTCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-2067s1c1
Sequence:CCGGGCAATTTCAACCCTGACCAATCTCGAGATTGGTCAGGGTTGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019701
CLCNKB MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive Kb
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-233s1c1
Sequence:CCGGCTATGCTATGAACTTCACTATCTCGAGATAGTGAAGTTCATAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-798s1c1
Sequence:CCGGCTGGCGGTCTTCAACAATGAACTCGAGTTCATTGTTGAAGACCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-1893s1c1
Sequence:CCGGCTCCAGGATATCTTGGCTAATCTCGAGATTAGCCAAGATATCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-623s1c1
Sequence:CCGGGACCAAAGAAATGGAACTGTTCTCGAGAACAGTTCCATTTCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-2067s1c1
Sequence:CCGGGCAATTTCAACCCTGACCAATCTCGAGATTGGTCAGGGTTGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019701
CLCNKB MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive Kb
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-233s1c1
Sequence:CCGGCTATGCTATGAACTTCACTATCTCGAGATAGTGAAGTTCATAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-798s1c1
Sequence:CCGGCTGGCGGTCTTCAACAATGAACTCGAGTTCATTGTTGAAGACCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-1893s1c1
Sequence:CCGGCTCCAGGATATCTTGGCTAATCTCGAGATTAGCCAAGATATCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-623s1c1
Sequence:CCGGGACCAAAGAAATGGAACTGTTCTCGAGAACAGTTCCATTTCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019701.1-2067s1c1
Sequence:CCGGGCAATTTCAACCCTGACCAATCTCGAGATTGGTCAGGGTTGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000085
CLCNKB MISSION shRNA Bacterial Glycerol Stock
chloride channel, voltage-sensitive Kb
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-943s1c1
Sequence:CCGGGCGAATCTTCTTTGGCTTCATCTCGAGATGAAGCCAAAGAAGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-1316s1c1
Sequence:CCGGCCCATCTTTGTCTATGGAGCTCTCGAGAGCTCCATAGACAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-310s1c1
Sequence:CCGGGTATCTCTCCTGGACTGTGTACTCGAGTACACAGTCCAGGAGAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-343s1c1
Sequence:CCGGCGTCTCTTTCTCTTCGGGCTTCTCGAGAAGCCCGAAGAGAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-1958s1c1
Sequence:CCGGCATGAGGCACACAACCTCTTTCTCGAGAAAGAGGTTGTGTGCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000085
CLCNKB MISSION shRNA shRNA Plasmid DNA
chloride channel, voltage-sensitive Kb
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-943s1c1
Sequence:CCGGGCGAATCTTCTTTGGCTTCATCTCGAGATGAAGCCAAAGAAGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-1316s1c1
Sequence:CCGGCCCATCTTTGTCTATGGAGCTCTCGAGAGCTCCATAGACAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-310s1c1
Sequence:CCGGGTATCTCTCCTGGACTGTGTACTCGAGTACACAGTCCAGGAGAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-343s1c1
Sequence:CCGGCGTCTCTTTCTCTTCGGGCTTCTCGAGAAGCCCGAAGAGAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-1958s1c1
Sequence:CCGGCATGAGGCACACAACCTCTTTCTCGAGAAAGAGGTTGTGTGCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000085
CLCNKB MISSION shRNA Lentiviral Transduction Particles
chloride channel, voltage-sensitive Kb
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-943s1c1
Sequence:CCGGGCGAATCTTCTTTGGCTTCATCTCGAGATGAAGCCAAAGAAGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-1316s1c1
Sequence:CCGGCCCATCTTTGTCTATGGAGCTCTCGAGAGCTCCATAGACAAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-310s1c1
Sequence:CCGGGTATCTCTCCTGGACTGTGTACTCGAGTACACAGTCCAGGAGAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-343s1c1
Sequence:CCGGCGTCTCTTTCTCTTCGGGCTTCTCGAGAAGCCCGAAGAGAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000085.1-1958s1c1
Sequence:CCGGCATGAGGCACACAACCTCTTTCTCGAGAAAGAGGTTGTGTGCCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks