EMAIL THIS PAGE TO A FRIEND

CLDN10

claudin 10

104 Gene Product Result for
Synonyms: CPETRL3 OSP-L
UniProtKB ID: P78369, Q96N78
Gene ID:
Human(9071) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The expression level of this gene is associated with recurrence of primary hepatocellular carcinoma. Six alternatively spliced transcript variants encoding different isoforms have been reported, but the transcript sequences of some variants are not determined.[provided by RefSeq, Jun 2010]
Mouse(58187) claudin 10
Rat(290485) claudin 10
sheep(101107876) claudin 10
Zebrafish(368619) claudin 10
cow(506545) claudin 10
dog(476963) claudin 10
chicken(418790) claudin 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006984 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147351 MISSION® esiRNA esiRNA human CLDN10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006984 Rosetta Predictions human pricing
NM_182848 Rosetta Predictions human pricing
NM_001106058 Rosetta Predictions rat pricing
NM_021386 Rosetta Predictions mouse pricing
NM_023878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021241 predicted 556
2 SASI_Hs01_00021242 predicted 632
3 SASI_Hs01_00021243 predicted 801
4 SASI_Hs01_00021244 predicted 870
5 SASI_Hs01_00021245 predicted 993
6 SASI_Hs01_00021246 predicted 746
7 SASI_Hs01_00021248 predicted 471
8 SASI_Hs02_00342720 predicted 805
9 SASI_Hs01_00021249 predicted 748
10 SASI_Hs02_00342721 predicted 636
11 SASI_Hs01_00021240 predicted 484
12 SASI_Hs01_00021247 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140188 predicted 737
2 SASI_Hs01_00140189 predicted 807
3 SASI_Hs01_00140190 predicted 978
4 SASI_Hs01_00140191 predicted 1045
5 SASI_Hs01_00140192 predicted 1174
6 SASI_Hs01_00140193 predicted 917
7 SASI_Hs01_00140195 predicted 648
8 SASI_Hs02_00370980 predicted 981
9 SASI_Hs01_00140196 predicted 931
10 SASI_Hs02_00370981 predicted 819
11 SASI_Hs01_00140187 predicted 660
12 SASI_Hs01_00140194 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215212 predicted 805
2 SASI_Rn02_00215213 predicted 413
3 SASI_Rn02_00215214 predicted 974
4 SASI_Rn02_00215215 predicted 723
5 SASI_Rn02_00215216 predicted 507
6 SASI_Rn02_00215217 predicted 927
7 SASI_Rn02_00215218 predicted 345
8 SASI_Rn02_00215219 predicted 528
9 SASI_Rn02_00215220 predicted 567
10 SASI_Rn02_00215221 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109446 predicted 928
2 SASI_Mm01_00109449 predicted 860
3 SASI_Mm01_00109450 predicted 872
4 SASI_Mm01_00109451 predicted 258
5 SASI_Mm01_00109452 predicted 336
6 SASI_Mm02_00325976 predicted 921
7 SASI_Mm01_00109454 predicted 459
8 SASI_Mm02_00325977 predicted 856
9 SASI_Mm01_00109455 predicted 347
10 SASI_Mm02_00325978 predicted 721
11 SASI_Mm01_00109447 predicted 794
12 SASI_Mm01_00109448 predicted 966
13 SASI_Mm01_00109453 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327423 predicted 522
2 SASI_Mm02_00327424 predicted 842
3 SASI_Mm02_00327425 predicted 467
4 SASI_Mm01_00156593 predicted 435
5 SASI_Mm02_00327426 predicted 666
6 SASI_Mm02_00327427 predicted 851
7 SASI_Mm02_00327428 predicted 455
8 SASI_Mm02_00327429 predicted 551
9 SASI_Mm02_00327430 predicted 562
10 SASI_Mm01_00156596 predicted 383
11 SASI_Mm01_00156594 predicted 317
12 SASI_Mm01_00156595 predicted 435
13 SASI_Mm01_00156597 predicted 429
14 SASI_Mm01_00156598 predicted 410
15 SASI_Mm01_00156599 predicted 277
16 SASI_Mm01_00156600 predicted 323
17 SASI_Mm01_00156601 predicted 339
18 SASI_Mm01_00156602 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006984
CLDN10 MISSION shRNA Bacterial Glycerol Stock
claudin 10
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006984.4-373s21c1
Sequence:CCGGCAAAGTCGGAGGCTCCGATAACTCGAGTTATCGGAGCCTCCGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006984.3-658s1c1
Sequence:CCGGCGGACAAAGTATCATGGTGGACTCGAGTCCACCATGATACTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006984.3-338s1c1
Sequence:CCGGCGCTCTTTGGAATGAAGTGTACTCGAGTACACTTCATTCCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006984.3-1276s1c1
Sequence:CCGGGCAGCAAGTTATCTGGTAGAACTCGAGTTCTACCAGATAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006984.3-312s1c1
Sequence:CCGGCCTGGGCTTCTTTGGTTCCATCTCGAGATGGAACCAAAGAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006984.4-1063s21c1
Sequence:CCGGATTCATAGATAGAAGTCTTTGCTCGAGCAAAGACTTCTATCTATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006984
CLDN10 MISSION shRNA shRNA Plasmid DNA
claudin 10
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006984.4-373s21c1
Sequence:CCGGCAAAGTCGGAGGCTCCGATAACTCGAGTTATCGGAGCCTCCGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006984.3-658s1c1
Sequence:CCGGCGGACAAAGTATCATGGTGGACTCGAGTCCACCATGATACTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006984.3-338s1c1
Sequence:CCGGCGCTCTTTGGAATGAAGTGTACTCGAGTACACTTCATTCCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006984.3-1276s1c1
Sequence:CCGGGCAGCAAGTTATCTGGTAGAACTCGAGTTCTACCAGATAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006984.3-312s1c1
Sequence:CCGGCCTGGGCTTCTTTGGTTCCATCTCGAGATGGAACCAAAGAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006984.4-1063s21c1
Sequence:CCGGATTCATAGATAGAAGTCTTTGCTCGAGCAAAGACTTCTATCTATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006984
CLDN10 MISSION shRNA Lentiviral Transduction Particles
claudin 10
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006984.4-373s21c1
Sequence:CCGGCAAAGTCGGAGGCTCCGATAACTCGAGTTATCGGAGCCTCCGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006984.3-658s1c1
Sequence:CCGGCGGACAAAGTATCATGGTGGACTCGAGTCCACCATGATACTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006984.3-338s1c1
Sequence:CCGGCGCTCTTTGGAATGAAGTGTACTCGAGTACACTTCATTCCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006984.3-1276s1c1
Sequence:CCGGGCAGCAAGTTATCTGGTAGAACTCGAGTTCTACCAGATAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006984.3-312s1c1
Sequence:CCGGCCTGGGCTTCTTTGGTTCCATCTCGAGATGGAACCAAAGAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006984.4-1063s21c1
Sequence:CCGGATTCATAGATAGAAGTCTTTGCTCGAGCAAAGACTTCTATCTATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023878
CLDN10 MISSION shRNA Bacterial Glycerol Stock
claudin 10
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000091709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-433s1c1
Sequence:CCGGCCGGCCACATTTCACTATCTTCTCGAGAAGATAGTGAAATGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-472s1c1
Sequence:CCGGCCAGGCATGTAGAGGACTAATCTCGAGATTAGTCCTCTACATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-567s1c1
Sequence:CCGGGCTCAGATCAAGCCAAAGCTACTCGAGTAGCTTTGGCTTGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-799s1c1
Sequence:CCGGCAACAACAAGACACCCAGAATCTCGAGATTCTGGGTGTCTTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023878
CLDN10 MISSION shRNA shRNA Plasmid DNA
claudin 10
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000091709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-433s1c1
Sequence:CCGGCCGGCCACATTTCACTATCTTCTCGAGAAGATAGTGAAATGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-472s1c1
Sequence:CCGGCCAGGCATGTAGAGGACTAATCTCGAGATTAGTCCTCTACATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-567s1c1
Sequence:CCGGGCTCAGATCAAGCCAAAGCTACTCGAGTAGCTTTGGCTTGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-799s1c1
Sequence:CCGGCAACAACAAGACACCCAGAATCTCGAGATTCTGGGTGTCTTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023878
CLDN10 MISSION shRNA Lentiviral Transduction Particles
claudin 10
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000091709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-433s1c1
Sequence:CCGGCCGGCCACATTTCACTATCTTCTCGAGAAGATAGTGAAATGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-472s1c1
Sequence:CCGGCCAGGCATGTAGAGGACTAATCTCGAGATTAGTCCTCTACATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-567s1c1
Sequence:CCGGGCTCAGATCAAGCCAAAGCTACTCGAGTAGCTTTGGCTTGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023878.1-799s1c1
Sequence:CCGGCAACAACAAGACACCCAGAATCTCGAGATTCTGGGTGTCTTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks