EMAIL THIS PAGE TO A FRIEND

CLDN11

claudin 11

108 Gene Product Result for
Synonyms: OSP OTM
UniProtKB ID: O75508, B2R7C1, D3DNQ5, Q5U0P3
Gene ID:
Human(5010) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a major component of central nervous system (CNS) myelin and plays an important role in regulating proliferation and migration of oligodendrocytes. Mouse studies showed that the gene deficiency results in deafness and loss of the Sertoli cell epithelial phenotype in the testis. This protein is a tight junction protein at the human blood-testis barrier (BTB), and the BTB disruption is related to a dysfunction of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Aug 2010]
Mouse(18417) claudin 11
Rat(84588) claudin 11
chicken(424990) claudin 11
cow(508268) claudin 11
dog(488160) claudin 11
sheep(101113649) claudin 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502054 Anti-Claudin 11, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
HPA013166 Anti-CLDN11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV33628 Anti-CLDN11 antibody produced in rabbit affinity isolated antibody rabbit, bovine, canine, guinea pig, human, rat, pig, mouse, horse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005602 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155191 MISSION® esiRNA esiRNA human CLDN11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005602 Rosetta Predictions human pricing
NM_053457 Rosetta Predictions rat pricing
NM_008770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015089 predicted 785
2 SASI_Hs02_00339914 predicted 271
3 SASI_Hs01_00015090 predicted 631
4 SASI_Hs01_00015091 predicted 614
5 SASI_Hs01_00015092 predicted 786
6 SASI_Hs01_00015093 predicted 793
7 SASI_Hs01_00015094 predicted 909
8 SASI_Hs02_00339915 predicted 908
9 SASI_Hs01_00015096 predicted 2084
10 SASI_Hs01_00015097 predicted 1963
11 SASI_Hs01_00015095 predicted 1994
12 SASI_Hs01_00015098 predicted 2034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116454 predicted 279
2 SASI_Rn01_00116455 predicted 605
3 SASI_Rn01_00116457 predicted 472
4 SASI_Rn01_00116458 predicted 354
5 SASI_Rn01_00116459 predicted 643
6 SASI_Rn01_00116460 predicted 598
7 SASI_Rn01_00116461 predicted 443
8 SASI_Rn01_00116462 predicted 220
9 SASI_Rn01_00116463 predicted 410
10 SASI_Rn02_00266035 predicted 659
11 SASI_Rn01_00116456 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043234 predicted 1049
2 SASI_Mm01_00043235 predicted 1042
3 SASI_Mm01_00043236 predicted 967
4 SASI_Mm01_00043237 predicted 985
5 SASI_Mm01_00043238 predicted 882
6 SASI_Mm01_00043239 predicted 858
7 SASI_Mm01_00043240 predicted 1082
8 SASI_Mm02_00314662 predicted 631
9 SASI_Mm01_00043241 predicted 549
10 SASI_Mm01_00043242 predicted 1096
11 SASI_Mm01_00043243 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005602
CLDN11 MISSION shRNA Bacterial Glycerol Stock
claudin 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005602.4-1013s1c1
Sequence:CCGGGCTCAGATAATGCCCAGACATCTCGAGATGTCTGGGCATTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-487s1c1
Sequence:CCGGGCTGACTGTTCTTCCCTGCATCTCGAGATGCAGGGAAGAACAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-759s1c1
Sequence:CCGGTCTACTACACTGCGGGCTCTACTCGAGTAGAGCCCGCAGTGTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-253s1c1
Sequence:CCGGCATCGTGACCACCTCCACCAACTCGAGTTGGTGGAGGTGGTCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-632s1c1
Sequence:CCGGGAGACCACCATCGTGAGCTTTCTCGAGAAAGCTCACGATGGTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005602
CLDN11 MISSION shRNA shRNA Plasmid DNA
claudin 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005602.4-1013s1c1
Sequence:CCGGGCTCAGATAATGCCCAGACATCTCGAGATGTCTGGGCATTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-487s1c1
Sequence:CCGGGCTGACTGTTCTTCCCTGCATCTCGAGATGCAGGGAAGAACAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-759s1c1
Sequence:CCGGTCTACTACACTGCGGGCTCTACTCGAGTAGAGCCCGCAGTGTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-253s1c1
Sequence:CCGGCATCGTGACCACCTCCACCAACTCGAGTTGGTGGAGGTGGTCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-632s1c1
Sequence:CCGGGAGACCACCATCGTGAGCTTTCTCGAGAAAGCTCACGATGGTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005602
CLDN11 MISSION shRNA Lentiviral Transduction Particles
claudin 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005602.4-1013s1c1
Sequence:CCGGGCTCAGATAATGCCCAGACATCTCGAGATGTCTGGGCATTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-487s1c1
Sequence:CCGGGCTGACTGTTCTTCCCTGCATCTCGAGATGCAGGGAAGAACAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-759s1c1
Sequence:CCGGTCTACTACACTGCGGGCTCTACTCGAGTAGAGCCCGCAGTGTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-253s1c1
Sequence:CCGGCATCGTGACCACCTCCACCAACTCGAGTTGGTGGAGGTGGTCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005602.4-632s1c1
Sequence:CCGGGAGACCACCATCGTGAGCTTTCTCGAGAAAGCTCACGATGGTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008770
CLDN11 MISSION shRNA Bacterial Glycerol Stock
claudin 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008770.1-1604s1c1
Sequence:CCGGCCCTTCTATTTCTGTCTCCATCTCGAGATGGAGACAGAAATAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-393s1c1
Sequence:CCGGGCAGGCTTGTAGAGCCCTCATCTCGAGATGAGGGCTCTACAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-601s1c1
Sequence:CCGGGAGATCACCATCGTGAGCTTTCTCGAGAAAGCTCACGATGGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-222s1c1
Sequence:CCGGCATCGTCACAACGTCCACCAACTCGAGTTGGTGGACGTTGTGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-201s1c1
Sequence:CCGGCTTCGTGGGTTGGATTGGCATCTCGAGATGCCAATCCAACCCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008770
CLDN11 MISSION shRNA shRNA Plasmid DNA
claudin 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008770.1-1604s1c1
Sequence:CCGGCCCTTCTATTTCTGTCTCCATCTCGAGATGGAGACAGAAATAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-393s1c1
Sequence:CCGGGCAGGCTTGTAGAGCCCTCATCTCGAGATGAGGGCTCTACAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-601s1c1
Sequence:CCGGGAGATCACCATCGTGAGCTTTCTCGAGAAAGCTCACGATGGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-222s1c1
Sequence:CCGGCATCGTCACAACGTCCACCAACTCGAGTTGGTGGACGTTGTGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-201s1c1
Sequence:CCGGCTTCGTGGGTTGGATTGGCATCTCGAGATGCCAATCCAACCCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008770
CLDN11 MISSION shRNA Lentiviral Transduction Particles
claudin 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008770.1-1604s1c1
Sequence:CCGGCCCTTCTATTTCTGTCTCCATCTCGAGATGGAGACAGAAATAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-393s1c1
Sequence:CCGGGCAGGCTTGTAGAGCCCTCATCTCGAGATGAGGGCTCTACAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-601s1c1
Sequence:CCGGGAGATCACCATCGTGAGCTTTCTCGAGAAAGCTCACGATGGTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-222s1c1
Sequence:CCGGCATCGTCACAACGTCCACCAACTCGAGTTGGTGGACGTTGTGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008770.1-201s1c1
Sequence:CCGGCTTCGTGGGTTGGATTGGCATCTCGAGATGCCAATCCAACCCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks