EMAIL THIS PAGE TO A FRIEND

CLDN12

claudin 12

153 Gene Product Result for
UniProtKB ID: P56749, D6W5Q4, Q7LDZ0
Gene ID:
Human(9069) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is expressed in the inner ear and bladder epithelium, and it is over-expressed in colorectal carcinomas. This protein and claudin 2 are critical for vitamin D-dependent Ca2+ absorption between enterocytes. Multiple alternatively spliced transcript variants encoding the same protein have been found.[provided by RefSeq, Sep 2011]
Mouse(64945) claudin 12
Rat(500000) claudin 12
Zebrafish(81593) claudin 12
chicken(771872) claudin 12
Horse(100060361) claudin 12
cow(538709) claudin 12
dog(608397) claudin 12
sheep(101108741) claudin 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012129 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012129 Rosetta Predictions human pricing
NM_001100813 Rosetta Predictions rat pricing
NM_022890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067048 predicted 954
2 SASI_Hs01_00067049 predicted 320
3 SASI_Hs01_00067050 predicted 635
4 SASI_Hs01_00067051 predicted 361
5 SASI_Hs01_00067052 predicted 292
6 SASI_Hs01_00067053 predicted 238
7 SASI_Hs01_00067054 predicted 308
8 SASI_Hs01_00067055 predicted 1023
9 SASI_Hs01_00067056 predicted 351
10 SASI_Hs01_00067057 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210632 predicted 802
2 SASI_Rn02_00210633 predicted 927
3 SASI_Rn02_00210634 predicted 972
4 SASI_Rn02_00210635 predicted 794
5 SASI_Rn02_00210636 predicted 604
6 SASI_Rn02_00210637 predicted 1100
7 SASI_Rn02_00210638 predicted 988
8 SASI_Rn02_00210639 predicted 569
9 SASI_Rn02_00210640 predicted 447
10 SASI_Rn02_00210641 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094312 predicted 1010
2 SASI_Mm01_00094313 predicted 806
3 SASI_Mm01_00094314 predicted 388
4 SASI_Mm01_00094315 predicted 626
5 SASI_Mm01_00094316 predicted 777
6 SASI_Mm01_00094317 predicted 1112
7 SASI_Mm01_00094318 predicted 461
8 SASI_Mm01_00094319 predicted 403
9 SASI_Mm01_00094320 predicted 658
10 SASI_Mm01_00094321 predicted 1022
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022890
VALIDATED
CLDN12 MISSION shRNA Bacterial Glycerol Stock
claudin 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022890.1-2257s1c1
Sequence:CCGGGCCGTAATAATGGTCTCAGATCTCGAGATCTGAGACCATTATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022890.1-627s1c1
Sequence:CCGGCCTTCAATTCTTCCGTGCCTACTCGAGTAGGCACGGAAGAATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022890.1-948s1c1
Sequence:CCGGCTTACTCACAGCCCTATTCATCTCGAGATGAATAGGGCTGTGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022890.1-403s1c1
Sequence:CCGGGCTGATCACATTCAACAGAAACTCGAGTTTCTGTTGAATGTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022890.1-791s1c1
Sequence:CCGGCCGGTCTTTACCTTTGACTATCTCGAGATAGTCAAAGGTAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022890
VALIDATED
CLDN12 MISSION shRNA shRNA Plasmid DNA
claudin 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022890.1-2257s1c1
Sequence:CCGGGCCGTAATAATGGTCTCAGATCTCGAGATCTGAGACCATTATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022890.1-627s1c1
Sequence:CCGGCCTTCAATTCTTCCGTGCCTACTCGAGTAGGCACGGAAGAATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022890.1-948s1c1
Sequence:CCGGCTTACTCACAGCCCTATTCATCTCGAGATGAATAGGGCTGTGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022890.1-403s1c1
Sequence:CCGGGCTGATCACATTCAACAGAAACTCGAGTTTCTGTTGAATGTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022890.1-791s1c1
Sequence:CCGGCCGGTCTTTACCTTTGACTATCTCGAGATAGTCAAAGGTAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022890
VALIDATED
CLDN12 MISSION shRNA Lentiviral Transduction Particles
claudin 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022890.1-2257s1c1
Sequence:CCGGGCCGTAATAATGGTCTCAGATCTCGAGATCTGAGACCATTATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022890.1-627s1c1
Sequence:CCGGCCTTCAATTCTTCCGTGCCTACTCGAGTAGGCACGGAAGAATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022890.1-948s1c1
Sequence:CCGGCTTACTCACAGCCCTATTCATCTCGAGATGAATAGGGCTGTGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022890.1-403s1c1
Sequence:CCGGGCTGATCACATTCAACAGAAACTCGAGTTTCTGTTGAATGTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022890.1-791s1c1
Sequence:CCGGCCGGTCTTTACCTTTGACTATCTCGAGATAGTCAAAGGTAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012129
CLDN12 MISSION shRNA Bacterial Glycerol Stock
claudin 12
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-743s1c1
Sequence:CCGGCCTGTTTATGACTTCCCTTATCTCGAGATAAGGGAAGTCATAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-638s1c1
Sequence:CCGGCCCATCTATCTGGGTCATCTTCTCGAGAAGATGACCCAGATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-904s1c1
Sequence:CCGGCAGTAGTTTCACACACCACTTCTCGAGAAGTGGTGTGTGAAACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-391s1c1
Sequence:CCGGGCCTGATGTACGACACTACTTCTCGAGAAGTAGTGTCGTACATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012129.2-1349s21c1
Sequence:CCGGATTTCAGGTAAGGGTAATATTCTCGAGAATATTACCCTTACCTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012129.2-1193s21c1
Sequence:CCGGTGCATCACAATTGAGGTAATGCTCGAGCATTACCTCAATTGTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012129
CLDN12 MISSION shRNA shRNA Plasmid DNA
claudin 12
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-743s1c1
Sequence:CCGGCCTGTTTATGACTTCCCTTATCTCGAGATAAGGGAAGTCATAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-638s1c1
Sequence:CCGGCCCATCTATCTGGGTCATCTTCTCGAGAAGATGACCCAGATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-904s1c1
Sequence:CCGGCAGTAGTTTCACACACCACTTCTCGAGAAGTGGTGTGTGAAACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-391s1c1
Sequence:CCGGGCCTGATGTACGACACTACTTCTCGAGAAGTAGTGTCGTACATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012129.2-1349s21c1
Sequence:CCGGATTTCAGGTAAGGGTAATATTCTCGAGAATATTACCCTTACCTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012129.2-1193s21c1
Sequence:CCGGTGCATCACAATTGAGGTAATGCTCGAGCATTACCTCAATTGTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012129
CLDN12 MISSION shRNA Lentiviral Transduction Particles
claudin 12
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-743s1c1
Sequence:CCGGCCTGTTTATGACTTCCCTTATCTCGAGATAAGGGAAGTCATAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-638s1c1
Sequence:CCGGCCCATCTATCTGGGTCATCTTCTCGAGAAGATGACCCAGATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-904s1c1
Sequence:CCGGCAGTAGTTTCACACACCACTTCTCGAGAAGTGGTGTGTGAAACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012129.2-391s1c1
Sequence:CCGGGCCTGATGTACGACACTACTTCTCGAGAAGTAGTGTCGTACATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012129.2-1349s21c1
Sequence:CCGGATTTCAGGTAAGGGTAATATTCTCGAGAATATTACCCTTACCTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012129.2-1193s21c1
Sequence:CCGGTGCATCACAATTGAGGTAATGCTCGAGCATTACCTCAATTGTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks