EMAIL THIS PAGE TO A FRIEND

CLDN14

claudin 14

56 Gene Product Result for
Synonyms: DFNB29
UniProtKB ID: O95500
Gene ID:
Human(23562) Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. The encoded protein also binds specifically to the WW domain of Yes-associated protein. Defects in this gene are the cause of an autosomal recessive form of nonsyndromic sensorineural deafness. It is also reported that four synonymous variants in this gene are associated with kidney stones and reduced bone mineral density. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(56173) claudin 14
Rat(304073) claudin 14
sheep(101109068) claudin 14
chicken(427982) claudin 14
cow(783180) claudin 14
dog(487751) claudin 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012130 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152121 MISSION® esiRNA esiRNA human CLDN14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012130 Rosetta Predictions human pricing
NM_144492 Rosetta Predictions human pricing
NM_001013429 Rosetta Predictions rat pricing
NM_019500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185178 predicted 828
2 SASI_Hs01_00185179 predicted 551
3 SASI_Hs01_00185180 predicted 431
4 SASI_Hs01_00185181 predicted 828
5 SASI_Hs01_00185182 predicted 316
6 SASI_Hs01_00185183 predicted 386
7 SASI_Hs01_00185184 predicted 311
8 SASI_Hs01_00185185 predicted 314
9 SASI_Hs01_00185186 predicted 550
10 SASI_Hs01_00185187 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201377 predicted 1552
2 SASI_Hs01_00201378 predicted 1277
3 SASI_Hs01_00201379 predicted 1159
4 SASI_Hs01_00201380 predicted 1552
5 SASI_Hs01_00201381 predicted 1037
6 SASI_Hs01_00201382 predicted 1106
7 SASI_Hs01_00201383 predicted 1042
8 SASI_Hs01_00201384 predicted 1042
9 SASI_Hs01_00201385 predicted 1273
10 SASI_Hs01_00201386 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040202 predicted 497
2 SASI_Rn01_00040203 predicted 534
3 SASI_Rn01_00040204 predicted 1162
4 SASI_Rn01_00040206 predicted 1160
5 SASI_Rn01_00040207 predicted 1157
6 SASI_Rn01_00040209 predicted 773
7 SASI_Rn01_00040210 predicted 812
8 SASI_Rn01_00040211 predicted 963
9 SASI_Rn02_00201099 predicted 1153
10 SASI_Rn02_00201100 predicted 652
11 SASI_Rn01_00040205 predicted 885
12 SASI_Rn01_00040208 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146792 predicted 946
2 SASI_Mm02_00324537 predicted 1114
3 SASI_Mm01_00146793 predicted 1222
4 SASI_Mm01_00146794 predicted 1222
5 SASI_Mm01_00146795 predicted 946
6 SASI_Mm01_00146796 predicted 1212
7 SASI_Mm01_00146797 predicted 1015
8 SASI_Mm01_00146798 predicted 941
9 SASI_Mm01_00146799 predicted 711
10 SASI_Mm01_00146800 predicted 865
11 SASI_Mm01_00146801 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019500
CLDN14 MISSION shRNA Bacterial Glycerol Stock
claudin 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019500.3-1295s1c1
Sequence:CCGGGACCAATGATGGATGTGGGAACTCGAGTTCCCACATCCATCATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-1131s1c1
Sequence:CCGGCCGGAGCTACCACCACGGCTACTCGAGTAGCCGTGGTGGTAGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-989s1c1
Sequence:CCGGCCCAGTGGCATGAAGTTTGAACTCGAGTTCAAACTTCATGCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-1230s1c1
Sequence:CCGGACAGGCTGAATGACTACGTGTCTCGAGACACGTAGTCATTCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-950s1c1
Sequence:CCGGACGAATGACGTGGTGCAGAATCTCGAGATTCTGCACCACGTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019500
CLDN14 MISSION shRNA shRNA Plasmid DNA
claudin 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019500.3-1295s1c1
Sequence:CCGGGACCAATGATGGATGTGGGAACTCGAGTTCCCACATCCATCATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-1131s1c1
Sequence:CCGGCCGGAGCTACCACCACGGCTACTCGAGTAGCCGTGGTGGTAGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-989s1c1
Sequence:CCGGCCCAGTGGCATGAAGTTTGAACTCGAGTTCAAACTTCATGCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-1230s1c1
Sequence:CCGGACAGGCTGAATGACTACGTGTCTCGAGACACGTAGTCATTCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-950s1c1
Sequence:CCGGACGAATGACGTGGTGCAGAATCTCGAGATTCTGCACCACGTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019500
CLDN14 MISSION shRNA Lentiviral Transduction Particles
claudin 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019500.3-1295s1c1
Sequence:CCGGGACCAATGATGGATGTGGGAACTCGAGTTCCCACATCCATCATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-1131s1c1
Sequence:CCGGCCGGAGCTACCACCACGGCTACTCGAGTAGCCGTGGTGGTAGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-989s1c1
Sequence:CCGGCCCAGTGGCATGAAGTTTGAACTCGAGTTCAAACTTCATGCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-1230s1c1
Sequence:CCGGACAGGCTGAATGACTACGTGTCTCGAGACACGTAGTCATTCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019500.3-950s1c1
Sequence:CCGGACGAATGACGTGGTGCAGAATCTCGAGATTCTGCACCACGTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012130
CLDN14 MISSION shRNA Bacterial Glycerol Stock
claudin 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012130.2-944s1c1
Sequence:CCGGCAAAGTTTACTTCTGGGCAATCTCGAGATTGCCCAGAAGTAAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-276s1c1
Sequence:CCGGCCTACCTGAAAGGGCTCTGGACTCGAGTCCAGAGCCCTTTCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-602s1c1
Sequence:CCGGAGCGGCATGAAGTTTGAGATTCTCGAGAATCTCAAACTTCATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-473s1c1
Sequence:CCGGACACCCGCCAAGACCACCTTTCTCGAGAAAGGTGGTCTTGGCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-782s1c1
Sequence:CCGGCCAGCTGCCTACAAAGACAATCTCGAGATTGTCTTTGTAGGCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012130.2-838s21c1
Sequence:CCGGGTACAGGCTGAACGACTACGTCTCGAGACGTAGTCGTTCAGCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012130.2-1004s21c1
Sequence:CCGGCTTTAGAGCACAGGGACAGAGCTCGAGCTCTGTCCCTGTGCTCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012130.2-981s21c1
Sequence:CCGGATAATGTGAATGCGAGGAAATCTCGAGATTTCCTCGCATTCACATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012130
CLDN14 MISSION shRNA shRNA Plasmid DNA
claudin 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012130.2-944s1c1
Sequence:CCGGCAAAGTTTACTTCTGGGCAATCTCGAGATTGCCCAGAAGTAAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-276s1c1
Sequence:CCGGCCTACCTGAAAGGGCTCTGGACTCGAGTCCAGAGCCCTTTCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-602s1c1
Sequence:CCGGAGCGGCATGAAGTTTGAGATTCTCGAGAATCTCAAACTTCATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-473s1c1
Sequence:CCGGACACCCGCCAAGACCACCTTTCTCGAGAAAGGTGGTCTTGGCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-782s1c1
Sequence:CCGGCCAGCTGCCTACAAAGACAATCTCGAGATTGTCTTTGTAGGCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012130.2-838s21c1
Sequence:CCGGGTACAGGCTGAACGACTACGTCTCGAGACGTAGTCGTTCAGCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012130.2-1004s21c1
Sequence:CCGGCTTTAGAGCACAGGGACAGAGCTCGAGCTCTGTCCCTGTGCTCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012130.2-981s21c1
Sequence:CCGGATAATGTGAATGCGAGGAAATCTCGAGATTTCCTCGCATTCACATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012130
CLDN14 MISSION shRNA Lentiviral Transduction Particles
claudin 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012130.2-944s1c1
Sequence:CCGGCAAAGTTTACTTCTGGGCAATCTCGAGATTGCCCAGAAGTAAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-276s1c1
Sequence:CCGGCCTACCTGAAAGGGCTCTGGACTCGAGTCCAGAGCCCTTTCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-602s1c1
Sequence:CCGGAGCGGCATGAAGTTTGAGATTCTCGAGAATCTCAAACTTCATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-473s1c1
Sequence:CCGGACACCCGCCAAGACCACCTTTCTCGAGAAAGGTGGTCTTGGCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012130.2-782s1c1
Sequence:CCGGCCAGCTGCCTACAAAGACAATCTCGAGATTGTCTTTGTAGGCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012130.2-838s21c1
Sequence:CCGGGTACAGGCTGAACGACTACGTCTCGAGACGTAGTCGTTCAGCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012130.2-1004s21c1
Sequence:CCGGCTTTAGAGCACAGGGACAGAGCTCGAGCTCTGTCCCTGTGCTCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012130.2-981s21c1
Sequence:CCGGATAATGTGAATGCGAGGAAATCTCGAGATTTCCTCGCATTCACATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks