EMAIL THIS PAGE TO A FRIEND

CLDN15

claudin 15

59 Gene Product Result for
UniProtKB ID: P56746, B3KPB5
Gene ID:
Human(24146) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(60363) claudin 15
Rat(304388) claudin 15
chicken(424768) claudin 15
cow(514998) claudin 15
dog(608226) claudin 15
sheep(101121229) claudin 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138429 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124961 MISSION® esiRNA esiRNA human CLDN15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014343 Rosetta Predictions human pricing
NM_138429 Rosetta Predictions human pricing
NM_001107135 Rosetta Predictions rat pricing
NM_021719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013511 predicted 345
2 SASI_Hs01_00013512 predicted 667
3 SASI_Hs01_00013513 predicted 919
4 SASI_Hs02_00345486 predicted 646
5 SASI_Hs01_00013514 predicted 372
6 SASI_Hs01_00013515 predicted 919
7 SASI_Hs01_00013516 predicted 263
8 SASI_Hs02_00345487 predicted 650
9 SASI_Hs01_00013517 predicted 386
10 SASI_Hs01_00013518 predicted 425
11 SASI_Hs01_00013519 predicted 498
12 SASI_Hs01_00013520 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108571 predicted 270
2 SASI_Hs01_00108572 predicted 494
3 SASI_Hs01_00108573 predicted 288
4 SASI_Hs01_00108574 predicted 473
5 SASI_Hs01_00108575 predicted 304
6 SASI_Hs01_00108576 predicted 799
7 SASI_Hs01_00108577 predicted 348
8 SASI_Hs01_00108578 predicted 684
9 SASI_Hs01_00108579 predicted 549
10 SASI_Hs01_00108580 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225845 predicted 1089
2 SASI_Rn02_00225846 predicted 1393
3 SASI_Rn02_00225847 predicted 696
4 SASI_Rn02_00225848 predicted 662
5 SASI_Rn02_00225849 predicted 839
6 SASI_Rn02_00225850 predicted 345
7 SASI_Rn02_00225851 predicted 1206
8 SASI_Rn02_00225852 predicted 375
9 SASI_Rn02_00225853 predicted 489
10 SASI_Rn02_00225854 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195326 predicted 1270
2 SASI_Mm01_00195327 predicted 1400
3 SASI_Mm01_00195328 predicted 826
4 SASI_Mm01_00195329 predicted 1354
5 SASI_Mm01_00195331 predicted 323
6 SASI_Mm01_00195332 predicted 554
7 SASI_Mm01_00195333 predicted 682
8 SASI_Mm01_00195334 predicted 933
9 SASI_Mm02_00326418 predicted 1359
10 SASI_Mm02_00326419 predicted 1348
11 SASI_Mm01_00195325 predicted 1167
12 SASI_Mm01_00195330 predicted 1189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021719
VALIDATED
CLDN15 MISSION shRNA Bacterial Glycerol Stock
claudin 15
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021719.3-301s21c1
Sequence:CCGGGTTGACCCTTTCAAACAGCTACTCGAGTAGCTGTTTGAAAGGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021719.3-655s21c1
Sequence:CCGGCGTCAACATCACTACTGACTTCTCGAGAAGTCAGTAGTGATGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021719.3-880s21c1
Sequence:CCGGTGACATCAGCTTCGGTAAATACTCGAGTATTTACCGAAGCTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021719.3-1159s21c1
Sequence:CCGGGCAGCATGTGACTCCATATAACTCGAGTTATATGGAGTCACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021719.1-1160s1c1
Sequence:CCGGGCAGCATGTGACTCCATATAACTCGAGTTATATGGAGTCACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021719.1-836s1c1
Sequence:CCGGCAAGCCTTCTACGGTTGTGATCTCGAGATCACAACCGTAGAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021719.1-302s1c1
Sequence:CCGGGTTGACCCTTTCAAACAGCTACTCGAGTAGCTGTTTGAAAGGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021719.1-879s1c1
Sequence:CCGGAGTGACATCAGCTTCGGTAAACTCGAGTTTACCGAAGCTGATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021719.1-656s1c1
Sequence:CCGGCGTCAACATCACTACTGACTTCTCGAGAAGTCAGTAGTGATGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021719
VALIDATED
CLDN15 MISSION shRNA shRNA Plasmid DNA
claudin 15
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021719.3-301s21c1
Sequence:CCGGGTTGACCCTTTCAAACAGCTACTCGAGTAGCTGTTTGAAAGGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021719.3-655s21c1
Sequence:CCGGCGTCAACATCACTACTGACTTCTCGAGAAGTCAGTAGTGATGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021719.3-880s21c1
Sequence:CCGGTGACATCAGCTTCGGTAAATACTCGAGTATTTACCGAAGCTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021719.3-1159s21c1
Sequence:CCGGGCAGCATGTGACTCCATATAACTCGAGTTATATGGAGTCACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021719.1-1160s1c1
Sequence:CCGGGCAGCATGTGACTCCATATAACTCGAGTTATATGGAGTCACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021719.1-836s1c1
Sequence:CCGGCAAGCCTTCTACGGTTGTGATCTCGAGATCACAACCGTAGAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021719.1-302s1c1
Sequence:CCGGGTTGACCCTTTCAAACAGCTACTCGAGTAGCTGTTTGAAAGGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021719.1-879s1c1
Sequence:CCGGAGTGACATCAGCTTCGGTAAACTCGAGTTTACCGAAGCTGATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021719.1-656s1c1
Sequence:CCGGCGTCAACATCACTACTGACTTCTCGAGAAGTCAGTAGTGATGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021719
VALIDATED
CLDN15 MISSION shRNA Lentiviral Transduction Particles
claudin 15
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021719.3-301s21c1
Sequence:CCGGGTTGACCCTTTCAAACAGCTACTCGAGTAGCTGTTTGAAAGGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021719.3-655s21c1
Sequence:CCGGCGTCAACATCACTACTGACTTCTCGAGAAGTCAGTAGTGATGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021719.3-880s21c1
Sequence:CCGGTGACATCAGCTTCGGTAAATACTCGAGTATTTACCGAAGCTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021719.3-1159s21c1
Sequence:CCGGGCAGCATGTGACTCCATATAACTCGAGTTATATGGAGTCACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021719.1-1160s1c1
Sequence:CCGGGCAGCATGTGACTCCATATAACTCGAGTTATATGGAGTCACATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021719.1-836s1c1
Sequence:CCGGCAAGCCTTCTACGGTTGTGATCTCGAGATCACAACCGTAGAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021719.1-302s1c1
Sequence:CCGGGTTGACCCTTTCAAACAGCTACTCGAGTAGCTGTTTGAAAGGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021719.1-879s1c1
Sequence:CCGGAGTGACATCAGCTTCGGTAAACTCGAGTTTACCGAAGCTGATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021719.1-656s1c1
Sequence:CCGGCGTCAACATCACTACTGACTTCTCGAGAAGTCAGTAGTGATGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138429
CLDN15 MISSION shRNA Bacterial Glycerol Stock
claudin 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138429.1-744s1c1
Sequence:CCGGGCTGCTTTGTCCTCATCTAATCTCGAGATTAGATGAGGACAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-512s1c1
Sequence:CCGGGCGGTGTGTGTGCAGGGTATACTCGAGTATACCCTGCACACACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-433s1c1
Sequence:CCGGTGTCCGGCTGATGTCTATAAACTCGAGTTTATAGACATCAGCCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-300s1c1
Sequence:CCGGTCTTCGAGAACCTCTGGTTTACTCGAGTAAACCAGAGGTTCTCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-472s1c1
Sequence:CCGGGCGTCTTGCAAGTTGCAGGTTCTCGAGAACCTGCAACTTGCAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138429
CLDN15 MISSION shRNA shRNA Plasmid DNA
claudin 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138429.1-744s1c1
Sequence:CCGGGCTGCTTTGTCCTCATCTAATCTCGAGATTAGATGAGGACAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-512s1c1
Sequence:CCGGGCGGTGTGTGTGCAGGGTATACTCGAGTATACCCTGCACACACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-433s1c1
Sequence:CCGGTGTCCGGCTGATGTCTATAAACTCGAGTTTATAGACATCAGCCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-300s1c1
Sequence:CCGGTCTTCGAGAACCTCTGGTTTACTCGAGTAAACCAGAGGTTCTCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-472s1c1
Sequence:CCGGGCGTCTTGCAAGTTGCAGGTTCTCGAGAACCTGCAACTTGCAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138429
CLDN15 MISSION shRNA Lentiviral Transduction Particles
claudin 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138429.1-744s1c1
Sequence:CCGGGCTGCTTTGTCCTCATCTAATCTCGAGATTAGATGAGGACAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-512s1c1
Sequence:CCGGGCGGTGTGTGTGCAGGGTATACTCGAGTATACCCTGCACACACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-433s1c1
Sequence:CCGGTGTCCGGCTGATGTCTATAAACTCGAGTTTATAGACATCAGCCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-300s1c1
Sequence:CCGGTCTTCGAGAACCTCTGGTTTACTCGAGTAAACCAGAGGTTCTCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138429.1-472s1c1
Sequence:CCGGGCGTCTTGCAAGTTGCAGGTTCTCGAGAACCTGCAACTTGCAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks