EMAIL THIS PAGE TO A FRIEND

CLDN16

claudin 16

67 Gene Product Result for
Synonyms: HOMG3 PCLN1
UniProtKB ID: Q9Y5I7
Gene ID:
Human(10686) Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. It is found primarily in the kidneys, specifically in the thick ascending limb of Henle, where it acts as either an intercellular pore or ion concentration sensor to regulate the paracellular resorption of magnesium ions. Defects in this gene are a cause of primary hypomagnesemia, which is characterized by massive renal magnesium wasting with hypomagnesemia and hypercalciuria, resulting in nephrocalcinosis and renal failure. This gene and the CLDN1 gene are clustered on chromosome 3q28. [provided by RefSeq, Jun 2010]
Mouse(114141) claudin 16
Rat(155268) claudin 16
chicken(429147) claudin 16
cow(282184) claudin 16
dog(608218) claudin 16
sheep(101105382) claudin 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006580 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006580 Rosetta Predictions human pricing
NM_131905 Rosetta Predictions rat pricing
NM_053241 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057533 predicted 959
2 SASI_Hs01_00057534 predicted 504
3 SASI_Hs01_00057535 predicted 735
4 SASI_Hs01_00057536 predicted 987
5 SASI_Hs01_00057538 predicted 1046
6 SASI_Hs01_00057539 predicted 566
7 SASI_Hs01_00057540 predicted 510
8 SASI_Hs01_00057542 predicted 684
9 SASI_Hs02_00341871 predicted 989
10 SASI_Hs02_00341872 predicted 885
11 SASI_Hs01_00057537 predicted 517
12 SASI_Hs01_00057541 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068436 predicted 911
2 SASI_Rn01_00068437 predicted 1130
3 SASI_Rn01_00068438 predicted 725
4 SASI_Rn01_00068439 predicted 668
5 SASI_Rn01_00068440 predicted 935
6 SASI_Rn01_00068441 predicted 1079
7 SASI_Rn01_00068443 predicted 1048
8 SASI_Rn01_00068444 predicted 1064
9 SASI_Rn02_00267532 predicted 711
10 SASI_Rn01_00068445 predicted 434
11 SASI_Rn01_00068442 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166661 predicted 466
2 SASI_Mm01_00166662 predicted 926
3 SASI_Mm01_00166663 predicted 567
4 SASI_Mm01_00166664 predicted 641
5 SASI_Mm01_00166665 predicted 393
6 SASI_Mm01_00166666 predicted 729
7 SASI_Mm02_00337839 predicted 709
8 SASI_Mm01_00166667 predicted 740
9 SASI_Mm01_00166668 predicted 907
10 SASI_Mm01_00166669 predicted 526
11 SASI_Mm01_00166670 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006580
CLDN16 MISSION shRNA Bacterial Glycerol Stock
claudin 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006580.2-1198s1c1
Sequence:CCGGGCACACACTTTCCCTATATTTCTCGAGAAATATAGGGAAAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-607s1c1
Sequence:CCGGCGTACATTAAAGTCCGCATCTCTCGAGAGATGCGGACTTTAATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-643s1c1
Sequence:CCGGCCACGTTACTAATAGCAGGTACTCGAGTACCTGCTATTAGTAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-861s1c1
Sequence:CCGGCCTGAGAGAAACTATCCTTATCTCGAGATAAGGATAGTTTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-531s1c1
Sequence:CCGGGCAGATATTCTAGCTGGGTTTCTCGAGAAACCCAGCTAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006580.2-1023s21c1
Sequence:CCGGTCAATCAGTATGGTTACATTGCTCGAGCAATGTAACCATACTGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006580.2-1057s21c1
Sequence:CCGCTCAATCCAGGAACAGTTATTTCTCGAGAAATAACTGTTCCTGGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006580.2-355s21c1
Sequence:CCGGCTGACTGTTGGATGGTGAATGCTCGAGCATTCACCATCCAACAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006580
CLDN16 MISSION shRNA shRNA Plasmid DNA
claudin 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006580.2-1198s1c1
Sequence:CCGGGCACACACTTTCCCTATATTTCTCGAGAAATATAGGGAAAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-607s1c1
Sequence:CCGGCGTACATTAAAGTCCGCATCTCTCGAGAGATGCGGACTTTAATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-643s1c1
Sequence:CCGGCCACGTTACTAATAGCAGGTACTCGAGTACCTGCTATTAGTAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-861s1c1
Sequence:CCGGCCTGAGAGAAACTATCCTTATCTCGAGATAAGGATAGTTTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-531s1c1
Sequence:CCGGGCAGATATTCTAGCTGGGTTTCTCGAGAAACCCAGCTAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006580.2-1023s21c1
Sequence:CCGGTCAATCAGTATGGTTACATTGCTCGAGCAATGTAACCATACTGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006580.2-1057s21c1
Sequence:CCGCTCAATCCAGGAACAGTTATTTCTCGAGAAATAACTGTTCCTGGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006580.2-355s21c1
Sequence:CCGGCTGACTGTTGGATGGTGAATGCTCGAGCATTCACCATCCAACAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006580
CLDN16 MISSION shRNA Lentiviral Transduction Particles
claudin 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006580.2-1198s1c1
Sequence:CCGGGCACACACTTTCCCTATATTTCTCGAGAAATATAGGGAAAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-607s1c1
Sequence:CCGGCGTACATTAAAGTCCGCATCTCTCGAGAGATGCGGACTTTAATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-643s1c1
Sequence:CCGGCCACGTTACTAATAGCAGGTACTCGAGTACCTGCTATTAGTAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-861s1c1
Sequence:CCGGCCTGAGAGAAACTATCCTTATCTCGAGATAAGGATAGTTTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006580.2-531s1c1
Sequence:CCGGGCAGATATTCTAGCTGGGTTTCTCGAGAAACCCAGCTAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006580.2-1023s21c1
Sequence:CCGGTCAATCAGTATGGTTACATTGCTCGAGCAATGTAACCATACTGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006580.2-1057s21c1
Sequence:CCGCTCAATCCAGGAACAGTTATTTCTCGAGAAATAACTGTTCCTGGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006580.2-355s21c1
Sequence:CCGGCTGACTGTTGGATGGTGAATGCTCGAGCATTCACCATCCAACAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053241
CLDN16 MISSION shRNA Bacterial Glycerol Stock
claudin 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-655s1c1
Sequence:CCGGCCACAAATTAAAGTCCGCCTTCTCGAGAAGGCGGACTTTAATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-910s1c1
Sequence:CCGGCCTGAGAGGAACTACCCTTATCTCGAGATAAGGGTAGTTCCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-509s1c1
Sequence:CCGGGCGATGAGTACGACTCCATATCTCGAGATATGGAGTCGTACTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-654s1c1
Sequence:CCGGCCCACAAATTAAAGTCCGCCTCTCGAGAGGCGGACTTTAATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-742s1c1
Sequence:CCGGGCTGTGGATGTTTACGTCGAACTCGAGTTCGACGTAAACATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053241
CLDN16 MISSION shRNA shRNA Plasmid DNA
claudin 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-655s1c1
Sequence:CCGGCCACAAATTAAAGTCCGCCTTCTCGAGAAGGCGGACTTTAATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-910s1c1
Sequence:CCGGCCTGAGAGGAACTACCCTTATCTCGAGATAAGGGTAGTTCCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-509s1c1
Sequence:CCGGGCGATGAGTACGACTCCATATCTCGAGATATGGAGTCGTACTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-654s1c1
Sequence:CCGGCCCACAAATTAAAGTCCGCCTCTCGAGAGGCGGACTTTAATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-742s1c1
Sequence:CCGGGCTGTGGATGTTTACGTCGAACTCGAGTTCGACGTAAACATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053241
CLDN16 MISSION shRNA Lentiviral Transduction Particles
claudin 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-655s1c1
Sequence:CCGGCCACAAATTAAAGTCCGCCTTCTCGAGAAGGCGGACTTTAATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-910s1c1
Sequence:CCGGCCTGAGAGGAACTACCCTTATCTCGAGATAAGGGTAGTTCCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-509s1c1
Sequence:CCGGGCGATGAGTACGACTCCATATCTCGAGATATGGAGTCGTACTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-654s1c1
Sequence:CCGGCCCACAAATTAAAGTCCGCCTCTCGAGAGGCGGACTTTAATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053241.2-742s1c1
Sequence:CCGGGCTGTGGATGTTTACGTCGAACTCGAGTTCGACGTAAACATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks