EMAIL THIS PAGE TO A FRIEND

CLDN17

claudin 17

45 Gene Product Result for
UniProtKB ID: P56750, Q3MJB5, Q6UY37
Gene ID:
Human(26285) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and is clustered with CLDN8 on chromosome 21q22.11. [provided by RefSeq, Jun 2010]
Mouse(239931) claudin 17
Rat(304125) claudin 17
sheep(780474) claudin 17
cow(512703) claudin 17
chicken(427973) claudin 17
dog(487720) claudin 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012131 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012131 Rosetta Predictions human pricing
NM_001107112 Rosetta Predictions rat pricing
NM_181490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024698 predicted 450
2 SASI_Hs01_00024699 predicted 318
3 SASI_Hs02_00343677 predicted 268
4 SASI_Hs01_00024700 predicted 418
5 SASI_Hs01_00024701 predicted 404
6 SASI_Hs01_00024702 predicted 246
7 SASI_Hs01_00024703 predicted 338
8 SASI_Hs01_00024704 predicted 264
9 SASI_Hs01_00024705 predicted 325
10 SASI_Hs01_00024706 predicted 257
11 SASI_Hs01_00024697 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225616 predicted 235
2 SASI_Rn02_00225617 predicted 268
3 SASI_Rn02_00225618 predicted 249
4 SASI_Rn02_00225619 predicted 954
5 SASI_Rn02_00225620 predicted 902
6 SASI_Rn02_00225621 predicted 556
7 SASI_Rn02_00225622 predicted 921
8 SASI_Rn02_00225623 predicted 444
9 SASI_Rn02_00225624 predicted 916
10 SASI_Rn02_00225625 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349791 predicted 554
2 SASI_Mm01_00077658 predicted 807
3 SASI_Mm01_00077659 predicted 261
4 SASI_Mm01_00077660 predicted 505
5 SASI_Mm01_00077661 predicted 244
6 SASI_Mm01_00077662 predicted 728
7 SASI_Mm01_00077663 predicted 200
8 SASI_Mm01_00077664 predicted 404
9 SASI_Mm01_00077665 predicted 326
10 SASI_Mm01_00077666 predicted 515
11 SASI_Mm01_00077667 predicted 330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012131
CLDN17 MISSION shRNA Bacterial Glycerol Stock
claudin 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012131.1-259s21c1
Sequence:CCGGGCTGTTGCTCTCTCCTTGATCCTCGAGGATCAAGGAGAGAGCAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012131.1-455s21c1
Sequence:CCGGCCATCCACATAGGTCAGAAACCTCGAGGTTTCTGACCTATGTGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012131.1-384s21c1
Sequence:CCGGGACGGGCATCTTCGTTCTGATCTCGAGATCAGAACGAAGATGCCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-180s1c1
Sequence:CCGGCCGGTTGCAATGCAAGTTCTACTCGAGTAGAACTTGCATTGCAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-341s1c1
Sequence:CCGGCCAAAGCATACCTTCTGGGAACTCGAGTTCCCAGAAGGTATGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-421s1c1
Sequence:CCGGGCCAATATAATCATCAGAGATCTCGAGATCTCTGATGATTATATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-113s1c1
Sequence:CCGGGCAACATTATTGTCTTTGAGACTCGAGTCTCAAAGACAATAATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-285s1c1
Sequence:CCGGGCTTATTGGCATCTGTGGCATCTCGAGATGCCACAGATGCCAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012131
CLDN17 MISSION shRNA shRNA Plasmid DNA
claudin 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012131.1-259s21c1
Sequence:CCGGGCTGTTGCTCTCTCCTTGATCCTCGAGGATCAAGGAGAGAGCAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012131.1-455s21c1
Sequence:CCGGCCATCCACATAGGTCAGAAACCTCGAGGTTTCTGACCTATGTGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012131.1-384s21c1
Sequence:CCGGGACGGGCATCTTCGTTCTGATCTCGAGATCAGAACGAAGATGCCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-180s1c1
Sequence:CCGGCCGGTTGCAATGCAAGTTCTACTCGAGTAGAACTTGCATTGCAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-341s1c1
Sequence:CCGGCCAAAGCATACCTTCTGGGAACTCGAGTTCCCAGAAGGTATGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-421s1c1
Sequence:CCGGGCCAATATAATCATCAGAGATCTCGAGATCTCTGATGATTATATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-113s1c1
Sequence:CCGGGCAACATTATTGTCTTTGAGACTCGAGTCTCAAAGACAATAATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-285s1c1
Sequence:CCGGGCTTATTGGCATCTGTGGCATCTCGAGATGCCACAGATGCCAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012131
CLDN17 MISSION shRNA Lentiviral Transduction Particles
claudin 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012131.1-259s21c1
Sequence:CCGGGCTGTTGCTCTCTCCTTGATCCTCGAGGATCAAGGAGAGAGCAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012131.1-455s21c1
Sequence:CCGGCCATCCACATAGGTCAGAAACCTCGAGGTTTCTGACCTATGTGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012131.1-384s21c1
Sequence:CCGGGACGGGCATCTTCGTTCTGATCTCGAGATCAGAACGAAGATGCCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-180s1c1
Sequence:CCGGCCGGTTGCAATGCAAGTTCTACTCGAGTAGAACTTGCATTGCAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-341s1c1
Sequence:CCGGCCAAAGCATACCTTCTGGGAACTCGAGTTCCCAGAAGGTATGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-421s1c1
Sequence:CCGGGCCAATATAATCATCAGAGATCTCGAGATCTCTGATGATTATATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-113s1c1
Sequence:CCGGGCAACATTATTGTCTTTGAGACTCGAGTCTCAAAGACAATAATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012131.1-285s1c1
Sequence:CCGGGCTTATTGGCATCTGTGGCATCTCGAGATGCCACAGATGCCAATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181490
CLDN17 MISSION shRNA Bacterial Glycerol Stock
claudin 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181490.2-838s1c1
Sequence:CCGGCCTGGCTTATGCTCATGTGTTCTCGAGAACACATGAGCATAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-757s1c1
Sequence:CCGGCAGAAGGATAACCAAAGGAATCTCGAGATTCCTTTGGTTATCCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-525s1c1
Sequence:CCGGGACTGGTATCTTCGTTCTGATCTCGAGATCAGAACGAAGATACCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-412s1c1
Sequence:CCGGGCCTTGGTTGCTCTCATTATTCTCGAGAATAATGAGAGCAACCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-249s1c1
Sequence:CCGGCGGCAGCAACATTATTATCTTCTCGAGAAGATAATAATGTTGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181490
CLDN17 MISSION shRNA shRNA Plasmid DNA
claudin 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181490.2-838s1c1
Sequence:CCGGCCTGGCTTATGCTCATGTGTTCTCGAGAACACATGAGCATAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-757s1c1
Sequence:CCGGCAGAAGGATAACCAAAGGAATCTCGAGATTCCTTTGGTTATCCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-525s1c1
Sequence:CCGGGACTGGTATCTTCGTTCTGATCTCGAGATCAGAACGAAGATACCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-412s1c1
Sequence:CCGGGCCTTGGTTGCTCTCATTATTCTCGAGAATAATGAGAGCAACCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-249s1c1
Sequence:CCGGCGGCAGCAACATTATTATCTTCTCGAGAAGATAATAATGTTGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181490
CLDN17 MISSION shRNA Lentiviral Transduction Particles
claudin 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181490.2-838s1c1
Sequence:CCGGCCTGGCTTATGCTCATGTGTTCTCGAGAACACATGAGCATAAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-757s1c1
Sequence:CCGGCAGAAGGATAACCAAAGGAATCTCGAGATTCCTTTGGTTATCCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-525s1c1
Sequence:CCGGGACTGGTATCTTCGTTCTGATCTCGAGATCAGAACGAAGATACCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-412s1c1
Sequence:CCGGGCCTTGGTTGCTCTCATTATTCTCGAGAATAATGAGAGCAACCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181490.2-249s1c1
Sequence:CCGGCGGCAGCAACATTATTATCTTCTCGAGAAGATAATAATGTTGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)