EMAIL THIS PAGE TO A FRIEND

CLDN18

claudin 18

135 Gene Product Result for
Synonyms: SFTA5 SFTPJ
UniProtKB ID: P56856, A5PL21, Q96PH4
Gene ID:
Human(51208) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is upregulated in patients with ulcerative colitis and highly overexpressed in infiltrating ductal adenocarcinomas. PKC/MAPK/AP-1 (protein kinase C/mitogen-activated protein kinase/activator protein-1) dependent pathway regulates the expression of this gene in gastric cells. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2010]
Mouse(56492) claudin 18
Rat(315953) claudin 18
chicken(429135) claudin 18
cow(511460) claudin 18
dog(477079) claudin 18
sheep(101112106) claudin 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108548 Anti-CLDN18 affinity isolated antibody mouse, rat, human, rat, guinea pig, rabbit, bovine, canine
western blot pricing
AV41431 Anti-CLDN18 antibody produced in rabbit affinity isolated antibody guinea pig, pig, horse, rabbit, rat, human, mouse, canine, bovine
immunohistochemistry, western blot pricing
SAB2104045 Anti-CLDN18 antibody produced in rabbit affinity isolated antibody pig, canine, mouse, rat, bovine, human, guinea pig, rabbit, horse
western blot pricing
SAB2104805 Anti-CLDN18 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, human, horse, rat, mouse
western blot pricing
HPA018446 Anti-CLDN18 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072421 MISSION® esiRNA esiRNA human CLDN18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002026 Rosetta Predictions human pricing
NM_016369 Rosetta Predictions human pricing
NM_001014096 Rosetta Predictions rat pricing
XM_001070861 Rosetta Predictions rat pricing
NM_019815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188191 predicted 823
2 SASI_Hs01_00188194 predicted 661
3 SASI_Hs01_00188195 predicted 1241
4 SASI_Hs01_00188196 predicted 470
5 SASI_Hs01_00188198 predicted 706
6 SASI_Hs02_00304087 predicted 646
7 SASI_Hs01_00188200 predicted 475
8 SASI_Hs02_00304088 predicted 613
9 SASI_Hs02_00304089 predicted 539
10 SASI_Hs02_00304090 predicted 972
11 SASI_Hs01_00188192 predicted 1008
12 SASI_Hs01_00188193 predicted 838
13 SASI_Hs01_00188197 predicted 908
14 SASI_Hs01_00188199 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203421 predicted 832
2 SASI_Hs01_00203424 predicted 668
3 SASI_Hs01_00203425 predicted 1251
4 SASI_Hs01_00203426 predicted 473
5 SASI_Hs01_00203428 predicted 713
6 SASI_Hs02_00349353 predicted 662
7 SASI_Hs01_00203430 predicted 485
8 SASI_Hs02_00349354 predicted 622
9 SASI_Hs02_00349355 predicted 554
10 SASI_Hs02_00349356 predicted 981
11 SASI_Hs01_00203422 predicted 1009
12 SASI_Hs01_00203423 predicted 840
13 SASI_Hs01_00203427 predicted 916
14 SASI_Hs01_00203429 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119995 predicted 1016
2 SASI_Rn02_00201530 predicted 592
3 SASI_Rn02_00201531 predicted 548
4 SASI_Rn01_00119997 predicted 926
5 SASI_Rn01_00119998 predicted 1112
6 SASI_Rn01_00119999 predicted 794
7 SASI_Rn01_00120000 predicted 922
8 SASI_Rn01_00120001 predicted 426
9 SASI_Rn01_00120002 predicted 521
10 SASI_Rn01_00120003 predicted 729
11 SASI_Rn01_00119996 predicted 899
12 SASI_Rn01_00120004 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333100 predicted 613
2 SASI_Rn02_00333101 predicted 341
3 SASI_Rn02_00333102 predicted 393
4 SASI_Rn02_00333103 predicted 569
5 SASI_Rn02_00333104 predicted 463
6 SASI_Rn02_00333105 predicted 284
7 SASI_Rn02_00333106 predicted 445
8 SASI_Rn02_00333107 predicted 535
9 SASI_Rn02_00333108 predicted 329
10 SASI_Rn02_00333109 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058517 predicted 1032
2 SASI_Mm01_00058518 predicted 481
3 SASI_Mm01_00058520 predicted 838
4 SASI_Mm02_00325092 predicted 942
5 SASI_Mm01_00058522 predicted 1033
6 SASI_Mm01_00058523 predicted 843
7 SASI_Mm01_00058524 predicted 1020
8 SASI_Mm01_00058525 predicted 832
9 SASI_Mm01_00058526 predicted 1007
10 SASI_Mm02_00325093 predicted 963
11 SASI_Mm01_00058519 predicted 700
12 SASI_Mm01_00058521 predicted 1028
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016369
CLDN18 MISSION shRNA Bacterial Glycerol Stock
claudin 18
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-360s1c1
Sequence:CCGGGCCCTGAAATGCATCCGCATTCTCGAGAATGCGGATGCATTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-503s1c1
Sequence:CCGGCTGGATGTCCACAGCTAACATCTCGAGATGTTAGCTGTGGACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016369.3-2405s1c1
Sequence:CCGGCCTCCCAAGTAGCTGGAATTACTCGAGTAATTCCAGCTACTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-804s1c1
Sequence:CCGGGAGGACGAGGTACAATCTTATCTCGAGATAAGATTGTACCTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-673s1c1
Sequence:CCGGCCAACTACAAAGCCGTTTCTTCTCGAGAAGAAACGGCTTTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016369.3-421s21c1
Sequence:CCGGCCTCCGGGATCATGTTCATTGCTCGAGCAATGAACATGATCCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016369.3-1195s21c1
Sequence:CCGGTAAACCCATTGATGATCTATTCTCGAGAATAGATCATCAATGGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016369.3-1057s21c1
Sequence:CCGGTAGAGGCTATAGCTCACATTTCTCGAGAAATGTGAGCTATAGCCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016369
CLDN18 MISSION shRNA shRNA Plasmid DNA
claudin 18
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-360s1c1
Sequence:CCGGGCCCTGAAATGCATCCGCATTCTCGAGAATGCGGATGCATTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-503s1c1
Sequence:CCGGCTGGATGTCCACAGCTAACATCTCGAGATGTTAGCTGTGGACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016369.3-2405s1c1
Sequence:CCGGCCTCCCAAGTAGCTGGAATTACTCGAGTAATTCCAGCTACTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-804s1c1
Sequence:CCGGGAGGACGAGGTACAATCTTATCTCGAGATAAGATTGTACCTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-673s1c1
Sequence:CCGGCCAACTACAAAGCCGTTTCTTCTCGAGAAGAAACGGCTTTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016369.3-421s21c1
Sequence:CCGGCCTCCGGGATCATGTTCATTGCTCGAGCAATGAACATGATCCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016369.3-1195s21c1
Sequence:CCGGTAAACCCATTGATGATCTATTCTCGAGAATAGATCATCAATGGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016369.3-1057s21c1
Sequence:CCGGTAGAGGCTATAGCTCACATTTCTCGAGAAATGTGAGCTATAGCCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016369
CLDN18 MISSION shRNA Lentiviral Transduction Particles
claudin 18
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-360s1c1
Sequence:CCGGGCCCTGAAATGCATCCGCATTCTCGAGAATGCGGATGCATTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-503s1c1
Sequence:CCGGCTGGATGTCCACAGCTAACATCTCGAGATGTTAGCTGTGGACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016369.3-2405s1c1
Sequence:CCGGCCTCCCAAGTAGCTGGAATTACTCGAGTAATTCCAGCTACTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-804s1c1
Sequence:CCGGGAGGACGAGGTACAATCTTATCTCGAGATAAGATTGTACCTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016369.3-673s1c1
Sequence:CCGGCCAACTACAAAGCCGTTTCTTCTCGAGAAGAAACGGCTTTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016369.3-421s21c1
Sequence:CCGGCCTCCGGGATCATGTTCATTGCTCGAGCAATGAACATGATCCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016369.3-1195s21c1
Sequence:CCGGTAAACCCATTGATGATCTATTCTCGAGAATAGATCATCAATGGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016369.3-1057s21c1
Sequence:CCGGTAGAGGCTATAGCTCACATTTCTCGAGAAATGTGAGCTATAGCCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019815
CLDN18 MISSION shRNA Bacterial Glycerol Stock
claudin 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-809s1c1
Sequence:CCGGGCCCGCACAGAAGACGATGAACTCGAGTTCATCGTCTTCTGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-311s1c1
Sequence:CCGGCTGATGATCGTGGGCATTGTTCTCGAGAACAATGCCCACGATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-364s1c1
Sequence:CCGGCGCCCTGAAGTGCATTCGCATCTCGAGATGCGAATGCACTTCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019815.1-2322s1c1
Sequence:CCGGCCAGGTTAATACGCAGAGTTTCTCGAGAAACTCTGCGTATTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-436s1c1
Sequence:CCGGCTTGTTCATCATCTCCGGCATCTCGAGATGCCGGAGATGATGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019815
CLDN18 MISSION shRNA shRNA Plasmid DNA
claudin 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-809s1c1
Sequence:CCGGGCCCGCACAGAAGACGATGAACTCGAGTTCATCGTCTTCTGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-311s1c1
Sequence:CCGGCTGATGATCGTGGGCATTGTTCTCGAGAACAATGCCCACGATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-364s1c1
Sequence:CCGGCGCCCTGAAGTGCATTCGCATCTCGAGATGCGAATGCACTTCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019815.1-2322s1c1
Sequence:CCGGCCAGGTTAATACGCAGAGTTTCTCGAGAAACTCTGCGTATTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-436s1c1
Sequence:CCGGCTTGTTCATCATCTCCGGCATCTCGAGATGCCGGAGATGATGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019815
CLDN18 MISSION shRNA Lentiviral Transduction Particles
claudin 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-809s1c1
Sequence:CCGGGCCCGCACAGAAGACGATGAACTCGAGTTCATCGTCTTCTGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-311s1c1
Sequence:CCGGCTGATGATCGTGGGCATTGTTCTCGAGAACAATGCCCACGATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-364s1c1
Sequence:CCGGCGCCCTGAAGTGCATTCGCATCTCGAGATGCGAATGCACTTCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019815.1-2322s1c1
Sequence:CCGGCCAGGTTAATACGCAGAGTTTCTCGAGAAACTCTGCGTATTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019815.1-436s1c1
Sequence:CCGGCTTGTTCATCATCTCCGGCATCTCGAGATGCCGGAGATGATGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks