EMAIL THIS PAGE TO A FRIEND

CLDN19

claudin 19

Synonyms: HOMG5
UniProtKB ID: Q8N6F1, B7Z5I2, F5H5P9, Q5QT57, Q8N8X0
Gene ID:
Human(149461) Summary: The product of this gene belongs to the claudin family. It plays a major role in tight junction-specific obliteration of the intercellular space, through calcium-independent cell-adhesion activity. Defects in this gene are the cause of hypomagnesemia renal with ocular involvement (HOMGO). HOMGO is a progressive renal disease characterized by primary renal magnesium wasting with hypomagnesemia, hypercalciuria and nephrocalcinosis associated with severe ocular abnormalities such as bilateral chorioretinal scars, macular colobomata, significant myopia and nystagmus. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Mouse(242653) claudin 19
Rat(298487) claudin 19
sheep(101102362) claudin 19
Zebrafish(550431) claudin 19
cow(513034) claudin 19
Horse(100053591) claudin 19
dog(607005) claudin 19
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148960 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153105 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153105 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153105 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074861 MISSION® esiRNA esiRNA targeting mouse Cldn19 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123395 Rosetta Predictions human pricing
NM_148960 Rosetta Predictions human pricing
NM_001008514 Rosetta Predictions rat pricing
NM_001038590 Rosetta Predictions mouse pricing
NM_153105 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327923 predicted 329
2 SASI_Hs02_00327924 predicted 1117
3 SASI_Hs02_00327925 predicted 1139
4 SASI_Hs02_00327926 predicted 682
5 SASI_Hs02_00327927 predicted 1314
6 SASI_Hs02_00327928 predicted 1292
7 SASI_Hs02_00327929 predicted 952
8 SASI_Hs02_00327930 predicted 762
9 SASI_Hs02_00327931 predicted 921
10 SASI_Hs02_00327932 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365668 predicted 1082
2 SASI_Hs01_00072865 predicted 1158
3 SASI_Hs01_00072868 predicted 333
4 SASI_Hs02_00365669 predicted 1027
5 SASI_Hs02_00365670 predicted 1078
6 SASI_Hs01_00072872 predicted 479
7 SASI_Hs02_00365671 predicted 1106
8 SASI_Hs02_00365672 predicted 1214
9 SASI_Hs02_00365673 predicted 593
10 SASI_Hs02_00365674 predicted 1137
11 SASI_Hs01_00072866 predicted 899
12 SASI_Hs01_00072867 predicted 689
13 SASI_Hs01_00072869 predicted 625
14 SASI_Hs01_00072870 predicted 764
15 SASI_Hs01_00072871 predicted 900
16 SASI_Hs01_00072873 predicted 961
17 SASI_Hs01_00072874 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089431 predicted 1029
2 SASI_Rn01_00089432 predicted 809
3 SASI_Rn01_00089433 predicted 969
4 SASI_Rn01_00089434 predicted 1188
5 SASI_Rn02_00199195 predicted 600
6 SASI_Rn01_00089435 predicted 539
7 SASI_Rn01_00089436 predicted 958
8 SASI_Rn01_00089437 predicted 264
9 SASI_Rn01_00089438 predicted 1003
10 SASI_Rn01_00089440 predicted 672
11 SASI_Rn01_00089439 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134400 predicted 244
2 SASI_Mm01_00134401 predicted 287
3 SASI_Mm01_00134402 predicted 501
4 SASI_Mm01_00134403 predicted 247
5 SASI_Mm01_00134404 predicted 284
6 SASI_Mm01_00134405 predicted 201
7 SASI_Mm01_00134406 predicted 200
8 SASI_Mm01_00134408 predicted 482
9 SASI_Mm01_00134409 predicted 246
10 SASI_Mm02_00289600 predicted 405
11 SASI_Mm01_00134407 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113650 predicted 279
2 SASI_Mm01_00113651 predicted 318
3 SASI_Mm01_00113652 predicted 528
4 SASI_Mm01_00113653 predicted 281
5 SASI_Mm01_00113654 predicted 314
6 SASI_Mm01_00113655 predicted 227
7 SASI_Mm01_00113656 predicted 231
8 SASI_Mm01_00113658 predicted 509
9 SASI_Mm01_00113659 predicted 279
10 SASI_Mm02_00342957 predicted 429
11 SASI_Mm01_00113657 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148960
CLDN19 MISSION shRNA Bacterial Glycerol Stock
claudin 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148960.2-409s21c1
Sequence:CCGGTGGACGGTCACATCCAATCAGCTCGAGCTGATTGGATGTGACCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148960.2-1062s21c1
Sequence:CCGGAGGTCCAGGGTGGGTTACATACTCGAGTATGTAACCCACCCTGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148960.2-959s21c1
Sequence:CCGGCATGGTATCATTCGGTCTGTCCTCGAGGACAGACCGAATGATACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148960.1-1574s1c1
Sequence:CCGGCCAAGGTCTTTGTCCTAGAATCTCGAGATTCTAGGACAAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-809s1c1
Sequence:CCGGTGCCCGAGAACCAGTTGTTAACTCGAGTTAACAACTGGTTCTCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-811s1c1
Sequence:CCGGCCCGAGAACCAGTTGTTAAATCTCGAGATTTAACAACTGGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-479s1c1
Sequence:CCGGCCTCAGCGTAGTTGGCATGAACTCGAGTTCATGCCAACTACGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-660s1c1
Sequence:CCGGGCCAGGTATGAATTTGGCCCACTCGAGTGGGCCAAATTCATACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148960
CLDN19 MISSION shRNA shRNA Plasmid DNA
claudin 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148960.2-409s21c1
Sequence:CCGGTGGACGGTCACATCCAATCAGCTCGAGCTGATTGGATGTGACCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148960.2-1062s21c1
Sequence:CCGGAGGTCCAGGGTGGGTTACATACTCGAGTATGTAACCCACCCTGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148960.2-959s21c1
Sequence:CCGGCATGGTATCATTCGGTCTGTCCTCGAGGACAGACCGAATGATACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148960.1-1574s1c1
Sequence:CCGGCCAAGGTCTTTGTCCTAGAATCTCGAGATTCTAGGACAAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-809s1c1
Sequence:CCGGTGCCCGAGAACCAGTTGTTAACTCGAGTTAACAACTGGTTCTCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-811s1c1
Sequence:CCGGCCCGAGAACCAGTTGTTAAATCTCGAGATTTAACAACTGGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-479s1c1
Sequence:CCGGCCTCAGCGTAGTTGGCATGAACTCGAGTTCATGCCAACTACGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-660s1c1
Sequence:CCGGGCCAGGTATGAATTTGGCCCACTCGAGTGGGCCAAATTCATACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148960
CLDN19 MISSION shRNA Lentiviral Transduction Particles
claudin 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148960.2-409s21c1
Sequence:CCGGTGGACGGTCACATCCAATCAGCTCGAGCTGATTGGATGTGACCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148960.2-1062s21c1
Sequence:CCGGAGGTCCAGGGTGGGTTACATACTCGAGTATGTAACCCACCCTGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148960.2-959s21c1
Sequence:CCGGCATGGTATCATTCGGTCTGTCCTCGAGGACAGACCGAATGATACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148960.1-1574s1c1
Sequence:CCGGCCAAGGTCTTTGTCCTAGAATCTCGAGATTCTAGGACAAAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-809s1c1
Sequence:CCGGTGCCCGAGAACCAGTTGTTAACTCGAGTTAACAACTGGTTCTCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-811s1c1
Sequence:CCGGCCCGAGAACCAGTTGTTAAATCTCGAGATTTAACAACTGGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-479s1c1
Sequence:CCGGCCTCAGCGTAGTTGGCATGAACTCGAGTTCATGCCAACTACGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148960.1-660s1c1
Sequence:CCGGGCCAGGTATGAATTTGGCCCACTCGAGTGGGCCAAATTCATACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153105
CLDN19 MISSION shRNA Bacterial Glycerol Stock
claudin 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153105.3-1101s1c1
Sequence:CCGGGCCTTCCATATTCCCTCCAATCTCGAGATTGGAGGGAATATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-525s1c1
Sequence:CCGGCCTGTCAATGCCAGGTACGAACTCGAGTTCGTACCTGGCATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-200s1c1
Sequence:CCGGCCTCTACGAAGGGCTGTGGATCTCGAGATCCACAGCCCTTCGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-478s1c1
Sequence:CCGGCCTGGTATGCTACCCTGGTAACTCGAGTTACCAGGGTAGCATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-245s1c1
Sequence:CCGGGCAGGTGCAATGCAAACTCTACTCGAGTAGAGTTTGCATTGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153105
CLDN19 MISSION shRNA shRNA Plasmid DNA
claudin 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153105.3-1101s1c1
Sequence:CCGGGCCTTCCATATTCCCTCCAATCTCGAGATTGGAGGGAATATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-525s1c1
Sequence:CCGGCCTGTCAATGCCAGGTACGAACTCGAGTTCGTACCTGGCATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-200s1c1
Sequence:CCGGCCTCTACGAAGGGCTGTGGATCTCGAGATCCACAGCCCTTCGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-478s1c1
Sequence:CCGGCCTGGTATGCTACCCTGGTAACTCGAGTTACCAGGGTAGCATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-245s1c1
Sequence:CCGGGCAGGTGCAATGCAAACTCTACTCGAGTAGAGTTTGCATTGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153105
CLDN19 MISSION shRNA Lentiviral Transduction Particles
claudin 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153105.3-1101s1c1
Sequence:CCGGGCCTTCCATATTCCCTCCAATCTCGAGATTGGAGGGAATATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-525s1c1
Sequence:CCGGCCTGTCAATGCCAGGTACGAACTCGAGTTCGTACCTGGCATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-200s1c1
Sequence:CCGGCCTCTACGAAGGGCTGTGGATCTCGAGATCCACAGCCCTTCGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-478s1c1
Sequence:CCGGCCTGGTATGCTACCCTGGTAACTCGAGTTACCAGGGTAGCATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153105.3-245s1c1
Sequence:CCGGGCAGGTGCAATGCAAACTCTACTCGAGTAGAGTTTGCATTGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks