EMAIL THIS PAGE TO A FRIEND

CLDN1

claudin 1

192 Gene Product Result for
Synonyms: CLD1 ILVASC SEMP1
UniProtKB ID: O95832
Gene ID:
Human(9076) Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. Loss of function mutations result in neonatal ichthyosis-sclerosing cholangitis syndrome. [provided by RefSeq, Jul 2008]
Mouse(12737) claudin 1
Rat(65129) claudin 1
Zebrafish(81590) claudin 1
dog(608207) claudin 1
cow(414922) claudin 1
chicken(424910) claudin 1
sheep(780473) claudin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503545 Anti-Claudin 1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4503546 Anti-Claudin 1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4200534 Anti-Claudin-1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, dog
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200462 Anti-Claudin-1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody rat, human
immunohistochemistry, western blot pricing
SAB5500083 Anti-Claudin-1 antibody, Rabbit monoclonal clone SP128, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB1406776 Anti-CLDN1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV33623 Anti-CLDN1 antibody produced in rabbit affinity isolated antibody guinea pig, bovine, mouse, human, horse, sheep, rabbit, canine, rat, pig
immunohistochemistry, western blot pricing
HPA048319 Anti-CLDN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB3500438 Anti-CLDN1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
WH0009076M1 Monoclonal Anti-CLDN1 antibody produced in mouse clone 1C5-D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB1404666 Monoclonal Anti-CLDN1 antibody produced in mouse clone 2E2-H5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation, western blot pricing
AMAB91213 Monoclonal Anti-CLDN1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3698, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021101 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021101 Rosetta Predictions human pricing
NM_031699 Rosetta Predictions rat pricing
NM_016674 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211216 predicted 672
2 SASI_Hs01_00211217 predicted 690
3 SASI_Hs01_00211218 predicted 392
4 SASI_Hs01_00211219 predicted 464
5 SASI_Hs02_00354587 predicted 399
6 SASI_Hs01_00211220 predicted 636
7 SASI_Hs01_00211221 predicted 628
8 SASI_Hs01_00211223 predicted 296
9 SASI_Hs01_00211224 predicted 509
10 SASI_Hs02_00354588 predicted 458
11 SASI_Hs01_00211222 predicted 534
12 SASI_Hs01_00211225 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075865 predicted 635
2 SASI_Rn01_00075866 predicted 789
3 SASI_Rn01_00075867 predicted 1070
4 SASI_Rn01_00075868 predicted 595
5 SASI_Rn01_00075869 predicted 547
6 SASI_Rn01_00075870 predicted 889
7 SASI_Rn01_00075871 predicted 875
8 SASI_Rn01_00075872 predicted 906
9 SASI_Rn01_00075873 predicted 896
10 SASI_Rn01_00075874 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076902 predicted 392
2 SASI_Mm02_00323307 predicted 814
3 SASI_Mm01_00076905 predicted 1126
4 SASI_Mm01_00076906 predicted 900
5 SASI_Mm01_00076907 predicted 803
6 SASI_Mm01_00076908 predicted 622
7 SASI_Mm02_00323308 predicted 905
8 SASI_Mm01_00076909 predicted 885
9 SASI_Mm01_00076910 predicted 1091
10 SASI_Mm02_00323309 predicted 933
11 SASI_Mm01_00076901 predicted 1111
12 SASI_Mm01_00076903 predicted 839
13 SASI_Mm01_00076904 predicted 909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021101
CLDN1 MISSION shRNA Bacterial Glycerol Stock
claudin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-305s1c1
Sequence:CCGGCAGTGGAGGATTTACTCCTATCTCGAGATAGGAGTAAATCCTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-626s1c1
Sequence:CCGGGCCACAGCATGGTATGGCAATCTCGAGATTGCCATACCATGCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-488s1c1
Sequence:CCGGCTGGGAGTGATAGCAATCTTTCTCGAGAAAGATTGCTATCACTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021101.3-1470s1c1
Sequence:CCGGGCATCGTTATTAAGCCCTTATCTCGAGATAAGGGCTTAATAACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-627s1c1
Sequence:CCGGCCACAGCATGGTATGGCAATACTCGAGTATTGCCATACCATGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021101.3-902s21c1
Sequence:CCGGGACATTGAGATACTATCATTACTCGAGTAATGATAGTATCTCAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021101.3-402s21c1
Sequence:CCGGAGATCCAGTGCAAAGTCTTTGCTCGAGCAAAGACTTTGCACTGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021101
CLDN1 MISSION shRNA shRNA Plasmid DNA
claudin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-305s1c1
Sequence:CCGGCAGTGGAGGATTTACTCCTATCTCGAGATAGGAGTAAATCCTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-626s1c1
Sequence:CCGGGCCACAGCATGGTATGGCAATCTCGAGATTGCCATACCATGCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-488s1c1
Sequence:CCGGCTGGGAGTGATAGCAATCTTTCTCGAGAAAGATTGCTATCACTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021101.3-1470s1c1
Sequence:CCGGGCATCGTTATTAAGCCCTTATCTCGAGATAAGGGCTTAATAACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-627s1c1
Sequence:CCGGCCACAGCATGGTATGGCAATACTCGAGTATTGCCATACCATGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021101.3-902s21c1
Sequence:CCGGGACATTGAGATACTATCATTACTCGAGTAATGATAGTATCTCAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021101.3-402s21c1
Sequence:CCGGAGATCCAGTGCAAAGTCTTTGCTCGAGCAAAGACTTTGCACTGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021101
CLDN1 MISSION shRNA Lentiviral Transduction Particles
claudin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-305s1c1
Sequence:CCGGCAGTGGAGGATTTACTCCTATCTCGAGATAGGAGTAAATCCTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-626s1c1
Sequence:CCGGGCCACAGCATGGTATGGCAATCTCGAGATTGCCATACCATGCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-488s1c1
Sequence:CCGGCTGGGAGTGATAGCAATCTTTCTCGAGAAAGATTGCTATCACTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021101.3-1470s1c1
Sequence:CCGGGCATCGTTATTAAGCCCTTATCTCGAGATAAGGGCTTAATAACGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021101.3-627s1c1
Sequence:CCGGCCACAGCATGGTATGGCAATACTCGAGTATTGCCATACCATGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021101.3-902s21c1
Sequence:CCGGGACATTGAGATACTATCATTACTCGAGTAATGATAGTATCTCAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021101.3-402s21c1
Sequence:CCGGAGATCCAGTGCAAAGTCTTTGCTCGAGCAAAGACTTTGCACTGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016674
CLDN1 MISSION shRNA Bacterial Glycerol Stock
claudin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016674.2-2752s1c1
Sequence:CCGGGCCTGGAACTTCTGTTGCTAACTCGAGTTAGCAACAGAAGTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-394s1c1
Sequence:CCGGGCAGATACAGTGCAAAGTCTTCTCGAGAAGACTTTGCACTGTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-494s1c1
Sequence:CCGGGCAATCTTTGTGTCCACCATTCTCGAGAATGGTGGACACAAAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-420s1c1
Sequence:CCGGCCTTGCTGAATCTGAACAGTACTCGAGTACTGTTCAGATTCAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-298s1c1
Sequence:CCGGCCAGTGGAAGATTTACTCCTACTCGAGTAGGAGTAAATCTTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016674
CLDN1 MISSION shRNA shRNA Plasmid DNA
claudin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016674.2-2752s1c1
Sequence:CCGGGCCTGGAACTTCTGTTGCTAACTCGAGTTAGCAACAGAAGTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-394s1c1
Sequence:CCGGGCAGATACAGTGCAAAGTCTTCTCGAGAAGACTTTGCACTGTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-494s1c1
Sequence:CCGGGCAATCTTTGTGTCCACCATTCTCGAGAATGGTGGACACAAAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-420s1c1
Sequence:CCGGCCTTGCTGAATCTGAACAGTACTCGAGTACTGTTCAGATTCAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-298s1c1
Sequence:CCGGCCAGTGGAAGATTTACTCCTACTCGAGTAGGAGTAAATCTTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016674
CLDN1 MISSION shRNA Lentiviral Transduction Particles
claudin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016674.2-2752s1c1
Sequence:CCGGGCCTGGAACTTCTGTTGCTAACTCGAGTTAGCAACAGAAGTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-394s1c1
Sequence:CCGGGCAGATACAGTGCAAAGTCTTCTCGAGAAGACTTTGCACTGTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-494s1c1
Sequence:CCGGGCAATCTTTGTGTCCACCATTCTCGAGAATGGTGGACACAAAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-420s1c1
Sequence:CCGGCCTTGCTGAATCTGAACAGTACTCGAGTACTGTTCAGATTCAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016674.2-298s1c1
Sequence:CCGGCCAGTGGAAGATTTACTCCTACTCGAGTAGGAGTAAATCTTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)