EMAIL THIS PAGE TO A FRIEND

CLDN20

claudin 20

43 Gene Product Result for
UniProtKB ID: P56880
Gene ID:
Human(49861) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. [provided by RefSeq, Jun 2010]
Mouse(621628) claudin 20
Rat(680178) claudin 20
sheep(101106178) claudin 20
chicken(769340) claudin 20
cow(101907895) claudin 20
cow(100140056) claudin 20
dog(608935) claudin 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001346 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160401 MISSION® esiRNA esiRNA human CLDN20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001346 Rosetta Predictions human pricing
NM_001109394 Rosetta Predictions rat pricing
NM_001101560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187925 predicted 857
2 SASI_Hs01_00187926 predicted 664
3 SASI_Hs01_00187927 predicted 781
4 SASI_Hs01_00187928 predicted 655
5 SASI_Hs01_00187929 predicted 666
6 SASI_Hs01_00187930 predicted 624
7 SASI_Hs01_00187931 predicted 633
8 SASI_Hs01_00187932 predicted 825
9 SASI_Hs01_00187933 predicted 845
10 SASI_Hs01_00187934 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247986 predicted 243
2 SASI_Rn02_00247987 predicted 291
3 SASI_Rn02_00247988 predicted 333
4 SASI_Rn02_00247989 predicted 394
5 SASI_Rn02_00247990 predicted 289
6 SASI_Rn02_00247991 predicted 257
7 SASI_Rn02_00247992 predicted 413
8 SASI_Rn02_00247993 predicted 328
9 SASI_Rn02_00247994 predicted 292
10 SASI_Rn02_00247995 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302588 predicted 377
2 SASI_Mm02_00302589 predicted 414
3 SASI_Mm02_00302590 predicted 388
4 SASI_Mm02_00302591 predicted 407
5 SASI_Mm02_00302592 predicted 405
6 SASI_Mm02_00302593 predicted 402
7 SASI_Mm02_00302594 predicted 295
8 SASI_Mm02_00302595 predicted 242
9 SASI_Mm02_00302596 predicted 280
10 SASI_Mm02_00302597 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101560
CLDN20 MISSION shRNA Bacterial Glycerol Stock
claudin 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-101s21c1
Sequence:CCGGCATACGCAGGACCCAACATTGCTCGAGCAATGTTGGGTCCTGCGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-413s21c1
Sequence:CCGGGGTACACCAAGGAGATCATAGCTCGAGCTATGATCTCCTTGGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-381s21c1
Sequence:CCGGTGCAGGGATCTCTGGTTTAATCTCGAGATTAAACCAGAGATCCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-454s21c1
Sequence:CCGGATTCCGGAAAGCCACAAATATCTCGAGATATTTGTGGCTTTCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-167s21c1
Sequence:CCGGGGTACAGCACTGGGATGTTTACTCGAGTAAACATCCCAGTGCTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101560
CLDN20 MISSION shRNA shRNA Plasmid DNA
claudin 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-101s21c1
Sequence:CCGGCATACGCAGGACCCAACATTGCTCGAGCAATGTTGGGTCCTGCGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-413s21c1
Sequence:CCGGGGTACACCAAGGAGATCATAGCTCGAGCTATGATCTCCTTGGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-381s21c1
Sequence:CCGGTGCAGGGATCTCTGGTTTAATCTCGAGATTAAACCAGAGATCCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-454s21c1
Sequence:CCGGATTCCGGAAAGCCACAAATATCTCGAGATATTTGTGGCTTTCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-167s21c1
Sequence:CCGGGGTACAGCACTGGGATGTTTACTCGAGTAAACATCCCAGTGCTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101560
CLDN20 MISSION shRNA Lentiviral Transduction Particles
claudin 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-101s21c1
Sequence:CCGGCATACGCAGGACCCAACATTGCTCGAGCAATGTTGGGTCCTGCGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-413s21c1
Sequence:CCGGGGTACACCAAGGAGATCATAGCTCGAGCTATGATCTCCTTGGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-381s21c1
Sequence:CCGGTGCAGGGATCTCTGGTTTAATCTCGAGATTAAACCAGAGATCCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-454s21c1
Sequence:CCGGATTCCGGAAAGCCACAAATATCTCGAGATATTTGTGGCTTTCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101560.1-167s21c1
Sequence:CCGGGGTACAGCACTGGGATGTTTACTCGAGTAAACATCCCAGTGCTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001346
CLDN20 MISSION shRNA Bacterial Glycerol Stock
claudin 20
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001346.1-1048s1c1
Sequence:CCGGGAGTAATGCATATGAAATGGACTCGAGTCCATTTCATATGCATTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-868s1c1
Sequence:CCGGGCTATCTATATCGGATTCATTCTCGAGAATGAATCCGATATAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-897s1c1
Sequence:CCGGGCTGTTGTTTATCTCTGGCATCTCGAGATGCCAGAGATAAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-1020s1c1
Sequence:CCGGCAATCTGAAGGATTATGTGTACTCGAGTACACATAATCCTTCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-1013s1c1
Sequence:CCGGCCACACACAATCTGAAGGATTCTCGAGAATCCTTCAGATTGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001346
CLDN20 MISSION shRNA shRNA Plasmid DNA
claudin 20
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001346.1-1048s1c1
Sequence:CCGGGAGTAATGCATATGAAATGGACTCGAGTCCATTTCATATGCATTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-868s1c1
Sequence:CCGGGCTATCTATATCGGATTCATTCTCGAGAATGAATCCGATATAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-897s1c1
Sequence:CCGGGCTGTTGTTTATCTCTGGCATCTCGAGATGCCAGAGATAAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-1020s1c1
Sequence:CCGGCAATCTGAAGGATTATGTGTACTCGAGTACACATAATCCTTCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-1013s1c1
Sequence:CCGGCCACACACAATCTGAAGGATTCTCGAGAATCCTTCAGATTGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001346
CLDN20 MISSION shRNA Lentiviral Transduction Particles
claudin 20
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001346.1-1048s1c1
Sequence:CCGGGAGTAATGCATATGAAATGGACTCGAGTCCATTTCATATGCATTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-868s1c1
Sequence:CCGGGCTATCTATATCGGATTCATTCTCGAGAATGAATCCGATATAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-897s1c1
Sequence:CCGGGCTGTTGTTTATCTCTGGCATCTCGAGATGCCAGAGATAAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-1020s1c1
Sequence:CCGGCAATCTGAAGGATTATGTGTACTCGAGTACACATAATCCTTCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001346.1-1013s1c1
Sequence:CCGGCCACACACAATCTGAAGGATTCTCGAGAATCCTTCAGATTGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks