EMAIL THIS PAGE TO A FRIEND

CLDN22

claudin 22

50 Gene Product Result for
Synonyms: CLDN21
UniProtKB ID: Q8N7P3
Gene ID:
Human(53842) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and overlaps the 3' UTR of the WWC2 gene (GeneID: 80014) on the opposite strand. [provided by RefSeq, Aug 2010]
Mouse(75677) claudin 22
Rat(306454) claudin 22
dog(482919) claudin 22
cow(616036) claudin 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301711 ANTI-CLDN22 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_357880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_357880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_357880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001111319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001111319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001111319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111319 Rosetta Predictions human pricing
NM_001110143 Rosetta Predictions rat pricing
NM_029383 Rosetta Predictions mouse pricing
XM_887785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325374 predicted 1405
2 SASI_Hs02_00325375 predicted 1204
3 SASI_Hs02_00325376 predicted 1331
4 SASI_Hs02_00325377 predicted 1205
5 SASI_Hs02_00325378 predicted 649
6 SASI_Hs02_00325379 predicted 1424
7 SASI_Hs02_00325380 predicted 1282
8 SASI_Hs02_00325381 predicted 1173
9 SASI_Hs02_00325382 predicted 1346
10 SASI_Hs02_00325383 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251052 predicted 682
2 SASI_Rn02_00251053 predicted 717
3 SASI_Rn02_00251054 predicted 224
4 SASI_Rn02_00251055 predicted 484
5 SASI_Rn02_00251056 predicted 538
6 SASI_Rn02_00251057 predicted 704
7 SASI_Rn02_00251058 predicted 282
8 SASI_Rn02_00251059 predicted 365
9 SASI_Rn02_00251060 predicted 677
10 SASI_Rn02_00251061 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335255 predicted 742
2 SASI_Mm02_00335256 predicted 716
3 SASI_Mm02_00335257 predicted 486
4 SASI_Mm02_00335258 predicted 460
5 SASI_Mm02_00335259 predicted 741
6 SASI_Mm02_00335260 predicted 689
7 SASI_Mm02_00335261 predicted 711
8 SASI_Mm02_00335262 predicted 420
9 SASI_Mm02_00335263 predicted 732
10 SASI_Mm02_00335264 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206389 predicted 434
2 SASI_Mm01_00206390 predicted 419
3 SASI_Mm01_00206391 predicted 372
4 SASI_Mm01_00206392 predicted 310
5 SASI_Mm01_00206393 predicted 298
6 SASI_Mm01_00206394 predicted 385
7 SASI_Mm01_00206395 predicted 300
8 SASI_Mm01_00206396 predicted 435
9 SASI_Mm01_00206397 predicted 387
10 SASI_Mm01_00206398 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_357880
CLDN22 MISSION shRNA Bacterial Glycerol Stock
claudin 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-93s1c1
Sequence:CCGGGCACTGGAAGAACCTTAACTTCTCGAGAAGTTAAGGTTCTTCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-448s1c1
Sequence:CCGGGATGAGACCATGCCTGAGATTCTCGAGAATCTCAGGCATGGTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-147s1c1
Sequence:CCGGGCTCTGGAAATCCTGCGTCATCTCGAGATGACGCAGGATTTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-102s1c1
Sequence:CCGGGAACCTTAACTTGGAGCTGAACTCGAGTTCAGCTCCAAGTTAAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-180s1c1
Sequence:CCGGCGGGAGGCAATGCAAGGACTTCTCGAGAAGTCCTTGCATTGCCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_357880
CLDN22 MISSION shRNA shRNA Plasmid DNA
claudin 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-93s1c1
Sequence:CCGGGCACTGGAAGAACCTTAACTTCTCGAGAAGTTAAGGTTCTTCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-448s1c1
Sequence:CCGGGATGAGACCATGCCTGAGATTCTCGAGAATCTCAGGCATGGTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-147s1c1
Sequence:CCGGGCTCTGGAAATCCTGCGTCATCTCGAGATGACGCAGGATTTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-102s1c1
Sequence:CCGGGAACCTTAACTTGGAGCTGAACTCGAGTTCAGCTCCAAGTTAAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-180s1c1
Sequence:CCGGCGGGAGGCAATGCAAGGACTTCTCGAGAAGTCCTTGCATTGCCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_357880
CLDN22 MISSION shRNA Lentiviral Transduction Particles
claudin 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-93s1c1
Sequence:CCGGGCACTGGAAGAACCTTAACTTCTCGAGAAGTTAAGGTTCTTCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-448s1c1
Sequence:CCGGGATGAGACCATGCCTGAGATTCTCGAGAATCTCAGGCATGGTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-147s1c1
Sequence:CCGGGCTCTGGAAATCCTGCGTCATCTCGAGATGACGCAGGATTTCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-102s1c1
Sequence:CCGGGAACCTTAACTTGGAGCTGAACTCGAGTTCAGCTCCAAGTTAAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357880.2-180s1c1
Sequence:CCGGCGGGAGGCAATGCAAGGACTTCTCGAGAAGTCCTTGCATTGCCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111319
CLDN22 MISSION shRNA Bacterial Glycerol Stock
claudin 22
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-1181s21c1
Sequence:CCGGCAAGAACTGGAGACGAGAAACCTCGAGGTTTCTCGTCTCCAGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-584s21c1
Sequence:CCGGCAACTAGCTGGAGTTTCATTACTCGAGTAATGAAACTCCAGCTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111319.1-2224s21c1
Sequence:CCGGACGACACTGAAATAGAGTATTCTCGAGAATACTCTATTTCAGTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-658s21c1
Sequence:CCGGGAACCTCAACCTGGACTTAAACTCGAGTTTAAGTCCAGGTTGAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-787s21c1
Sequence:CCGGCAGGGTCTCCAGGATCTTAATCTCGAGATTAAGATCCTGGAGACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111319
CLDN22 MISSION shRNA shRNA Plasmid DNA
claudin 22
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-1181s21c1
Sequence:CCGGCAAGAACTGGAGACGAGAAACCTCGAGGTTTCTCGTCTCCAGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-584s21c1
Sequence:CCGGCAACTAGCTGGAGTTTCATTACTCGAGTAATGAAACTCCAGCTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111319.1-2224s21c1
Sequence:CCGGACGACACTGAAATAGAGTATTCTCGAGAATACTCTATTTCAGTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-658s21c1
Sequence:CCGGGAACCTCAACCTGGACTTAAACTCGAGTTTAAGTCCAGGTTGAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-787s21c1
Sequence:CCGGCAGGGTCTCCAGGATCTTAATCTCGAGATTAAGATCCTGGAGACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111319
CLDN22 MISSION shRNA Lentiviral Transduction Particles
claudin 22
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-1181s21c1
Sequence:CCGGCAAGAACTGGAGACGAGAAACCTCGAGGTTTCTCGTCTCCAGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-584s21c1
Sequence:CCGGCAACTAGCTGGAGTTTCATTACTCGAGTAATGAAACTCCAGCTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111319.1-2224s21c1
Sequence:CCGGACGACACTGAAATAGAGTATTCTCGAGAATACTCTATTTCAGTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-658s21c1
Sequence:CCGGGAACCTCAACCTGGACTTAAACTCGAGTTTAAGTCCAGGTTGAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111319.1-787s21c1
Sequence:CCGGCAGGGTCTCCAGGATCTTAATCTCGAGATTAAGATCCTGGAGACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)