EMAIL THIS PAGE TO A FRIEND

CLDN25

claudin 25

30 Gene Product Result for
UniProtKB ID: C9JDP6
Gene ID:
Human(644672) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. [provided by RefSeq, Jun 2010]
Mouse(224250) claudin 25
chicken(428245) claudin 25
dog(489401) claudin 25
cow(522679) claudin 25
sheep(101114210) claudin 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_171826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_171826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_171826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001101389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101389 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042881 MISSION® esiRNA esiRNA targeting mouse Cldnd1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101389 Rosetta Predictions human pricing
NM_171826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322762 predicted 252
2 SASI_Hs02_00322763 predicted 319
3 SASI_Hs02_00322764 predicted 348
4 SASI_Hs02_00322765 predicted 374
5 SASI_Hs02_00322766 predicted 446
6 SASI_Hs02_00322767 predicted 292
7 SASI_Hs02_00322768 predicted 313
8 SASI_Hs02_00322769 predicted 376
9 SASI_Hs02_00322770 predicted 300
10 SASI_Hs02_00322771 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343634 predicted 1139
2 SASI_Mm01_00046567 predicted 325
3 SASI_Mm01_00046568 predicted 201
4 SASI_Mm01_00046569 predicted 337
5 SASI_Mm01_00046570 predicted 356
6 SASI_Mm02_00343635 predicted 1063
7 SASI_Mm01_00046571 predicted 373
8 SASI_Mm01_00046572 predicted 250
9 SASI_Mm01_00046573 predicted 231
10 SASI_Mm01_00046574 predicted 623
11 SASI_Mm01_00046575 predicted 366
12 SASI_Mm01_00046576 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_171826
VALIDATED
CLDN25 MISSION shRNA Bacterial Glycerol Stock
claudin 25
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_171826.1-91s1c1
Sequence:CCGGGCTTGTGTGCTTAGTCTGATTCTCGAGAATCAGACTAAGCACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171826.1-249s1c1
Sequence:CCGGCAACGATGTTCTGTTCCGATACTCGAGTATCGGAACAGAACATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171826.1-780s1c1
Sequence:CCGGGAAAGAGTACACCTTAATGAACTCGAGTTCATTAAGGTGTACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_171826.1-1156s1c1
Sequence:CCGGGCAGTAACTATGAAACTAGAACTCGAGTTCTAGTTTCATAGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_171826.1-347s1c1
Sequence:CCGGCAGAGTCATTTGATGTGGTTACTCGAGTAACCACATCAAATGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171826.2-251s21c1
Sequence:CCGGCAACGATGTTCTGTTCCGATACTCGAGTATCGGAACAGAACATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216738    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_171826.2-1632s1c1
Sequence:CCGGGTTCTAGCTGAGTACTATATGCTCGAGCATATAGTACTCAGCTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171826.2-782s21c1
Sequence:CCGGGAAAGAGTACACCTTAATGAACTCGAGTTCATTAAGGTGTACTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_171826.2-1158s21c1
Sequence:CCGGGCAGTAACTATGAAACTAGAACTCGAGTTCTAGTTTCATAGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171826.2-349s21c1
Sequence:CCGGCAGAGTCATTTGATGTGGTTACTCGAGTAACCACATCAAATGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_171826
VALIDATED
CLDN25 MISSION shRNA shRNA Plasmid DNA
claudin 25
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_171826.1-91s1c1
Sequence:CCGGGCTTGTGTGCTTAGTCTGATTCTCGAGAATCAGACTAAGCACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171826.1-249s1c1
Sequence:CCGGCAACGATGTTCTGTTCCGATACTCGAGTATCGGAACAGAACATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171826.1-780s1c1
Sequence:CCGGGAAAGAGTACACCTTAATGAACTCGAGTTCATTAAGGTGTACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_171826.1-1156s1c1
Sequence:CCGGGCAGTAACTATGAAACTAGAACTCGAGTTCTAGTTTCATAGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_171826.1-347s1c1
Sequence:CCGGCAGAGTCATTTGATGTGGTTACTCGAGTAACCACATCAAATGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171826.2-251s21c1
Sequence:CCGGCAACGATGTTCTGTTCCGATACTCGAGTATCGGAACAGAACATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216738    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_171826.2-1632s1c1
Sequence:CCGGGTTCTAGCTGAGTACTATATGCTCGAGCATATAGTACTCAGCTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171826.2-782s21c1
Sequence:CCGGGAAAGAGTACACCTTAATGAACTCGAGTTCATTAAGGTGTACTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_171826.2-1158s21c1
Sequence:CCGGGCAGTAACTATGAAACTAGAACTCGAGTTCTAGTTTCATAGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171826.2-349s21c1
Sequence:CCGGCAGAGTCATTTGATGTGGTTACTCGAGTAACCACATCAAATGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_171826
VALIDATED
CLDN25 MISSION shRNA Lentiviral Transduction Particles
claudin 25
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_171826.1-91s1c1
Sequence:CCGGGCTTGTGTGCTTAGTCTGATTCTCGAGAATCAGACTAAGCACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171826.1-249s1c1
Sequence:CCGGCAACGATGTTCTGTTCCGATACTCGAGTATCGGAACAGAACATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171826.1-780s1c1
Sequence:CCGGGAAAGAGTACACCTTAATGAACTCGAGTTCATTAAGGTGTACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_171826.1-1156s1c1
Sequence:CCGGGCAGTAACTATGAAACTAGAACTCGAGTTCTAGTTTCATAGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_171826.1-347s1c1
Sequence:CCGGCAGAGTCATTTGATGTGGTTACTCGAGTAACCACATCAAATGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171826.2-251s21c1
Sequence:CCGGCAACGATGTTCTGTTCCGATACTCGAGTATCGGAACAGAACATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216738    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_171826.2-1632s1c1
Sequence:CCGGGTTCTAGCTGAGTACTATATGCTCGAGCATATAGTACTCAGCTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171826.2-782s21c1
Sequence:CCGGGAAAGAGTACACCTTAATGAACTCGAGTTCATTAAGGTGTACTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_171826.2-1158s21c1
Sequence:CCGGGCAGTAACTATGAAACTAGAACTCGAGTTCTAGTTTCATAGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171826.2-349s21c1
Sequence:CCGGCAGAGTCATTTGATGTGGTTACTCGAGTAACCACATCAAATGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101389
CLDN25 MISSION shRNA Bacterial Glycerol Stock
claudin 25
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-291s21c1
Sequence:CCGGCTGCAGCTTTGGGTCTGAATGCTCGAGCATTCAGACCCAAAGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-370s21c1
Sequence:CCGGACTTTGGAGGCATCCGCTTCACTCGAGTGAAGCGGATGCCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-92s21c1
Sequence:CCGGCCCAGTGGAAGACTCTTAATCCTCGAGGATTAAGAGTCTTCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-322s21c1
Sequence:CCGGCACAGGATCAGATGGGTATTCCTCGAGGAATACCCATCTGATCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-452s21c1
Sequence:CCGGACAGCATCCCTGACATCATACCTCGAGGTATGATGTCAGGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101389
CLDN25 MISSION shRNA shRNA Plasmid DNA
claudin 25
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-291s21c1
Sequence:CCGGCTGCAGCTTTGGGTCTGAATGCTCGAGCATTCAGACCCAAAGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-370s21c1
Sequence:CCGGACTTTGGAGGCATCCGCTTCACTCGAGTGAAGCGGATGCCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-92s21c1
Sequence:CCGGCCCAGTGGAAGACTCTTAATCCTCGAGGATTAAGAGTCTTCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-322s21c1
Sequence:CCGGCACAGGATCAGATGGGTATTCCTCGAGGAATACCCATCTGATCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-452s21c1
Sequence:CCGGACAGCATCCCTGACATCATACCTCGAGGTATGATGTCAGGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101389
CLDN25 MISSION shRNA Lentiviral Transduction Particles
claudin 25
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-291s21c1
Sequence:CCGGCTGCAGCTTTGGGTCTGAATGCTCGAGCATTCAGACCCAAAGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-370s21c1
Sequence:CCGGACTTTGGAGGCATCCGCTTCACTCGAGTGAAGCGGATGCCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-92s21c1
Sequence:CCGGCCCAGTGGAAGACTCTTAATCCTCGAGGATTAAGAGTCTTCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-322s21c1
Sequence:CCGGCACAGGATCAGATGGGTATTCCTCGAGGAATACCCATCTGATCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101389.1-452s21c1
Sequence:CCGGACAGCATCCCTGACATCATACCTCGAGGTATGATGTCAGGGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks