EMAIL THIS PAGE TO A FRIEND

CLDN2

claudin 2

165 Gene Product Result for
UniProtKB ID: P57739, B2R6B9
Gene ID:
Human(9075) Summary: This gene product belongs to the claudin protein family whose members have been identified as major integral membrane proteins localized exclusively at tight junctions. Claudins are expressed in an organ-specific manner and regulate tissue-specific physiologic properties of tight junctions. This protein is expressed in the intestine. Alternatively spliced transcript variants with different 5' untranslated region have been found for this gene.[provided by RefSeq, Jan 2010]
Mouse(12738) claudin 2
Rat(300920) claudin 2
Zebrafish(562525) claudin 2
dog(403649) claudin 2
cow(404089) claudin 2
chicken(422292) claudin 2
sheep(780475) claudin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020384 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067041 MISSION® esiRNA esiRNA human CLDN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020384 Rosetta Predictions human pricing
NM_001106846 Rosetta Predictions rat pricing
NM_016675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034694 predicted 1096
2 SASI_Hs01_00034695 predicted 648
3 SASI_Hs01_00034696 predicted 494
4 SASI_Hs01_00034697 predicted 564
5 SASI_Hs01_00034698 predicted 1312
6 SASI_Hs01_00034699 predicted 785
7 SASI_Hs01_00034700 predicted 1301
8 SASI_Hs01_00034701 predicted 1131
9 SASI_Hs01_00034702 predicted 1220
10 SASI_Hs01_00034703 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222976 predicted 518
2 SASI_Rn02_00222977 predicted 1461
3 SASI_Rn02_00222978 predicted 1301
4 SASI_Rn02_00222979 predicted 1401
5 SASI_Rn02_00222980 predicted 802
6 SASI_Rn02_00222981 predicted 741
7 SASI_Rn02_00222982 predicted 527
8 SASI_Rn02_00222983 predicted 809
9 SASI_Rn02_00222984 predicted 830
10 SASI_Rn02_00222985 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136106 predicted 537
2 SASI_Mm01_00136107 predicted 1495
3 SASI_Mm01_00136108 predicted 1404
4 SASI_Mm01_00136109 predicted 623
5 SASI_Mm01_00136110 predicted 535
6 SASI_Mm01_00136111 predicted 603
7 SASI_Mm01_00136112 predicted 829
8 SASI_Mm01_00136113 predicted 439
9 SASI_Mm01_00136114 predicted 391
10 SASI_Mm01_00136115 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020384
CLDN2 MISSION shRNA Bacterial Glycerol Stock
claudin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-887s1c1
Sequence:CCGGCCAGAGAAATCGCTCCAACTACTCGAGTAGTTGGAGCGATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-813s1c1
Sequence:CCGGGCTCTTTACTTGGGCATTATTCTCGAGAATAATGCCCAAGTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-971s1c1
Sequence:CCGGCAAAGTCAAGAGTGAGTTCAACTCGAGTTGAACTCACTCTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-575s1c1
Sequence:CCGGGATGGTGACATCCAGTGCAATCTCGAGATTGCACTGGATGTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020384.3-815s21c1
Sequence:CCGGACAGCATGAAATTTGAGATTGCTCGAGCAATCTCAAATTTCATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020384.3-1338s21c1
Sequence:CCGGAGGACTCAGAGGATCCCTTTGCTCGAGCAAAGGGATCCTCTGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020384.3-1185s21c1
Sequence:CCGGGATTGAGCAAAGGCAGAAATGCTCGAGCATTTCTGCCTTTGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020384
CLDN2 MISSION shRNA shRNA Plasmid DNA
claudin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-887s1c1
Sequence:CCGGCCAGAGAAATCGCTCCAACTACTCGAGTAGTTGGAGCGATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-813s1c1
Sequence:CCGGGCTCTTTACTTGGGCATTATTCTCGAGAATAATGCCCAAGTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-971s1c1
Sequence:CCGGCAAAGTCAAGAGTGAGTTCAACTCGAGTTGAACTCACTCTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-575s1c1
Sequence:CCGGGATGGTGACATCCAGTGCAATCTCGAGATTGCACTGGATGTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020384.3-815s21c1
Sequence:CCGGACAGCATGAAATTTGAGATTGCTCGAGCAATCTCAAATTTCATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020384.3-1338s21c1
Sequence:CCGGAGGACTCAGAGGATCCCTTTGCTCGAGCAAAGGGATCCTCTGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020384.3-1185s21c1
Sequence:CCGGGATTGAGCAAAGGCAGAAATGCTCGAGCATTTCTGCCTTTGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020384
CLDN2 MISSION shRNA Lentiviral Transduction Particles
claudin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-887s1c1
Sequence:CCGGCCAGAGAAATCGCTCCAACTACTCGAGTAGTTGGAGCGATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-813s1c1
Sequence:CCGGGCTCTTTACTTGGGCATTATTCTCGAGAATAATGCCCAAGTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-971s1c1
Sequence:CCGGCAAAGTCAAGAGTGAGTTCAACTCGAGTTGAACTCACTCTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020384.2-575s1c1
Sequence:CCGGGATGGTGACATCCAGTGCAATCTCGAGATTGCACTGGATGTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020384.3-815s21c1
Sequence:CCGGACAGCATGAAATTTGAGATTGCTCGAGCAATCTCAAATTTCATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020384.3-1338s21c1
Sequence:CCGGAGGACTCAGAGGATCCCTTTGCTCGAGCAAAGGGATCCTCTGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020384.3-1185s21c1
Sequence:CCGGGATTGAGCAAAGGCAGAAATGCTCGAGCATTTCTGCCTTTGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016675
VALIDATED
CLDN2 MISSION shRNA Bacterial Glycerol Stock
claudin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016675.3-419s1c1
Sequence:CCGGGTTAGGCACATCCATTGCCATCTCGAGATGGCAATGGATGTGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016675.3-556s1c1
Sequence:CCGGGCGATATCTACAGTACCCTTTCTCGAGAAAGGGTACTGTAGATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016675.3-894s1c1
Sequence:CCGGGCCGGAGTCATCCTTTGCTTTCTCGAGAAAGCAAAGGATGACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016675.3-1741s1c1
Sequence:CCGGCCTGGGATCTAAAGAAACAAACTCGAGTTTGTTTCTTTAGATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016675.3-1016s1c1
Sequence:CCGGCAAGAGTGAGTTCAACTCATACTCGAGTATGAGTTGAACTCACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016675.3-1091s21c1
Sequence:CCGGGGTAGTGGCTGGGACTATATACTCGAGTATATAGTCCCAGCCACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-931s21c1
Sequence:CCGGGCAATCGTACCAACTACTATGCTCGAGCATAGTAGTTGGTACGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-633s21c1
Sequence:CCGGATGTCCTCGCTGGCTTGTATTCTCGAGAATACAAGCCAGCGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-817s21c1
Sequence:CCGGTGGTTCCTGACAGCATGAAATCTCGAGATTTCATGCTGTCAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-542s21c1
Sequence:CCGGAGGCATCACCCAGTGCGATATCTCGAGATATCGCACTGGGTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016675
VALIDATED
CLDN2 MISSION shRNA shRNA Plasmid DNA
claudin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016675.3-419s1c1
Sequence:CCGGGTTAGGCACATCCATTGCCATCTCGAGATGGCAATGGATGTGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016675.3-556s1c1
Sequence:CCGGGCGATATCTACAGTACCCTTTCTCGAGAAAGGGTACTGTAGATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016675.3-894s1c1
Sequence:CCGGGCCGGAGTCATCCTTTGCTTTCTCGAGAAAGCAAAGGATGACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016675.3-1741s1c1
Sequence:CCGGCCTGGGATCTAAAGAAACAAACTCGAGTTTGTTTCTTTAGATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016675.3-1016s1c1
Sequence:CCGGCAAGAGTGAGTTCAACTCATACTCGAGTATGAGTTGAACTCACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016675.3-1091s21c1
Sequence:CCGGGGTAGTGGCTGGGACTATATACTCGAGTATATAGTCCCAGCCACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-931s21c1
Sequence:CCGGGCAATCGTACCAACTACTATGCTCGAGCATAGTAGTTGGTACGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-633s21c1
Sequence:CCGGATGTCCTCGCTGGCTTGTATTCTCGAGAATACAAGCCAGCGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-817s21c1
Sequence:CCGGTGGTTCCTGACAGCATGAAATCTCGAGATTTCATGCTGTCAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-542s21c1
Sequence:CCGGAGGCATCACCCAGTGCGATATCTCGAGATATCGCACTGGGTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016675
VALIDATED
CLDN2 MISSION shRNA Lentiviral Transduction Particles
claudin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016675.3-419s1c1
Sequence:CCGGGTTAGGCACATCCATTGCCATCTCGAGATGGCAATGGATGTGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016675.3-556s1c1
Sequence:CCGGGCGATATCTACAGTACCCTTTCTCGAGAAAGGGTACTGTAGATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016675.3-894s1c1
Sequence:CCGGGCCGGAGTCATCCTTTGCTTTCTCGAGAAAGCAAAGGATGACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016675.3-1741s1c1
Sequence:CCGGCCTGGGATCTAAAGAAACAAACTCGAGTTTGTTTCTTTAGATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016675.3-1016s1c1
Sequence:CCGGCAAGAGTGAGTTCAACTCATACTCGAGTATGAGTTGAACTCACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016675.3-1091s21c1
Sequence:CCGGGGTAGTGGCTGGGACTATATACTCGAGTATATAGTCCCAGCCACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-931s21c1
Sequence:CCGGGCAATCGTACCAACTACTATGCTCGAGCATAGTAGTTGGTACGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-633s21c1
Sequence:CCGGATGTCCTCGCTGGCTTGTATTCTCGAGAATACAAGCCAGCGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-817s21c1
Sequence:CCGGTGGTTCCTGACAGCATGAAATCTCGAGATTTCATGCTGTCAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016675.3-542s21c1
Sequence:CCGGAGGCATCACCCAGTGCGATATCTCGAGATATCGCACTGGGTGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks