EMAIL THIS PAGE TO A FRIEND

CLDN3

claudin 3

63 Gene Product Result for
Synonyms: C7orf1 CPE-R2 CPETR2 HRVP1 RVP1
UniProtKB ID: O15551
Gene ID:
Human(1365) Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this intronless gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. It is also a low-affinity receptor for Clostridium perfringens enterotoxin, and shares aa sequence similarity with a putative apoptosis-related protein found in rat. [provided by RefSeq, Jul 2008]
Mouse(12739) claudin 3
Rat(65130) claudin 3
sheep(780476) claudin 3
chicken(374029) claudin 3
dog(403648) claudin 3
cow(404153) claudin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001306 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU038921 MISSION® esiRNA esiRNA targeting mouse Cldn3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001306 Rosetta Predictions human pricing
NM_031700 Rosetta Predictions rat pricing
NM_009902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068849 predicted 454
2 SASI_Hs01_00068851 predicted 570
3 SASI_Hs01_00068852 predicted 632
4 SASI_Hs01_00068855 predicted 328
5 SASI_Hs02_00331583 predicted 617
6 SASI_Hs01_00068856 predicted 422
7 SASI_Hs02_00331584 predicted 669
8 SASI_Hs02_00331585 predicted 538
9 SASI_Hs01_00068858 predicted 454
10 SASI_Hs02_00331586 predicted 511
11 SASI_Hs01_00068850 predicted 618
12 SASI_Hs01_00068853 predicted 601
13 SASI_Hs01_00068854 predicted 344
14 SASI_Hs01_00068857 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104958 predicted 783
2 SASI_Rn02_00265055 predicted 673
3 SASI_Rn01_00104959 predicted 846
4 SASI_Rn01_00104960 predicted 680
5 SASI_Rn01_00104961 predicted 1070
6 SASI_Rn01_00104962 predicted 512
7 SASI_Rn01_00104963 predicted 903
8 SASI_Rn01_00104964 predicted 1125
9 SASI_Rn01_00104965 predicted 1067
10 SASI_Rn01_00104966 predicted 517
11 SASI_Rn01_00104967 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185219 predicted 576
2 SASI_Mm01_00185223 predicted 301
3 SASI_Mm01_00185227 predicted 534
4 SASI_Mm02_00317404 predicted 335
5 SASI_Mm02_00317405 predicted 549
6 SASI_Mm02_00317406 predicted 530
7 SASI_Mm01_00185220 predicted 648
8 SASI_Mm01_00185221 predicted 857
9 SASI_Mm01_00185222 predicted 644
10 SASI_Mm02_00317407 predicted 640
11 SASI_Mm01_00185224 predicted 989
12 SASI_Mm01_00185225 predicted 820
13 SASI_Mm01_00185226 predicted 906
14 SASI_Mm01_00185228 predicted 987
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009902
VALIDATED
CLDN3 MISSION shRNA Bacterial Glycerol Stock
claudin 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-1100s1c1
Sequence:CCGGCCAAGCCGAATGGACAAAGAACTCGAGTTCTTTGTCCATTCGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009902.2-661s1c1
Sequence:CCGGCAGGGATTTCTATAACCCGTTCTCGAGAACGGGTTATAGAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-343s1c1
Sequence:CCGGCAGCATCATCACGGCGCAGATCTCGAGATCTGCGCCGTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-648s1c1
Sequence:CCGGCCAACACCATCATCAGGGATTCTCGAGAATCCCTGATGATGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-536s1c1
Sequence:CCGGCAGTGTACCAACTGCGTACAACTCGAGTTGTACGCAGTTGGTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009902.3-1099s21c1
Sequence:CCGGCCAAGCCGAATGGACAAAGAACTCGAGTTCTTTGTCCATTCGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009902.3-342s21c1
Sequence:CCGGCAGCATCATCACGGCGCAGATCTCGAGATCTGCGCCGTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009902.3-535s21c1
Sequence:CCGGCAGTGTACCAACTGCGTACAACTCGAGTTGTACGCAGTTGGTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009902.3-647s21c1
Sequence:CCGGCCAACACCATCATCAGGGATTCTCGAGAATCCCTGATGATGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009902
VALIDATED
CLDN3 MISSION shRNA shRNA Plasmid DNA
claudin 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-1100s1c1
Sequence:CCGGCCAAGCCGAATGGACAAAGAACTCGAGTTCTTTGTCCATTCGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009902.2-661s1c1
Sequence:CCGGCAGGGATTTCTATAACCCGTTCTCGAGAACGGGTTATAGAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-343s1c1
Sequence:CCGGCAGCATCATCACGGCGCAGATCTCGAGATCTGCGCCGTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-648s1c1
Sequence:CCGGCCAACACCATCATCAGGGATTCTCGAGAATCCCTGATGATGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-536s1c1
Sequence:CCGGCAGTGTACCAACTGCGTACAACTCGAGTTGTACGCAGTTGGTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009902.3-1099s21c1
Sequence:CCGGCCAAGCCGAATGGACAAAGAACTCGAGTTCTTTGTCCATTCGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009902.3-342s21c1
Sequence:CCGGCAGCATCATCACGGCGCAGATCTCGAGATCTGCGCCGTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009902.3-535s21c1
Sequence:CCGGCAGTGTACCAACTGCGTACAACTCGAGTTGTACGCAGTTGGTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009902.3-647s21c1
Sequence:CCGGCCAACACCATCATCAGGGATTCTCGAGAATCCCTGATGATGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009902
VALIDATED
CLDN3 MISSION shRNA Lentiviral Transduction Particles
claudin 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-1100s1c1
Sequence:CCGGCCAAGCCGAATGGACAAAGAACTCGAGTTCTTTGTCCATTCGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009902.2-661s1c1
Sequence:CCGGCAGGGATTTCTATAACCCGTTCTCGAGAACGGGTTATAGAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-343s1c1
Sequence:CCGGCAGCATCATCACGGCGCAGATCTCGAGATCTGCGCCGTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-648s1c1
Sequence:CCGGCCAACACCATCATCAGGGATTCTCGAGAATCCCTGATGATGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009902.2-536s1c1
Sequence:CCGGCAGTGTACCAACTGCGTACAACTCGAGTTGTACGCAGTTGGTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009902.3-1099s21c1
Sequence:CCGGCCAAGCCGAATGGACAAAGAACTCGAGTTCTTTGTCCATTCGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009902.3-342s21c1
Sequence:CCGGCAGCATCATCACGGCGCAGATCTCGAGATCTGCGCCGTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009902.3-535s21c1
Sequence:CCGGCAGTGTACCAACTGCGTACAACTCGAGTTGTACGCAGTTGGTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009902.3-647s21c1
Sequence:CCGGCCAACACCATCATCAGGGATTCTCGAGAATCCCTGATGATGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001306
CLDN3 MISSION shRNA Bacterial Glycerol Stock
claudin 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001306.2-308s1c1
Sequence:CCGGCAACATCATCACGTCGCAGAACTCGAGTTCTGCGACGTGATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001306.2-614s1c1
Sequence:CCGGCAACACCATTATCCGGGACTTCTCGAGAAGTCCCGGATAATGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001306.2-1073s1c1
Sequence:CCGGCCAACCTGCATGGACTGTGAACTCGAGTTCACAGTCCATGCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001306.2-254s1c1
Sequence:CCGGCACCATCGTGTGCTGCGCGTTCTCGAGAACGCGCAGCACACGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001306.3-873s21c1
Sequence:CCGGGACTACGTCTAAGGGACAGACCTCGAGGTCTGTCCCTTAGACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001306.3-630s21c1
Sequence:CCGGTGGTCGGCCAACACCATTATCCTCGAGGATAATGGTGTTGGCCGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001306
CLDN3 MISSION shRNA shRNA Plasmid DNA
claudin 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001306.2-308s1c1
Sequence:CCGGCAACATCATCACGTCGCAGAACTCGAGTTCTGCGACGTGATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001306.2-614s1c1
Sequence:CCGGCAACACCATTATCCGGGACTTCTCGAGAAGTCCCGGATAATGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001306.2-1073s1c1
Sequence:CCGGCCAACCTGCATGGACTGTGAACTCGAGTTCACAGTCCATGCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001306.2-254s1c1
Sequence:CCGGCACCATCGTGTGCTGCGCGTTCTCGAGAACGCGCAGCACACGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001306.3-873s21c1
Sequence:CCGGGACTACGTCTAAGGGACAGACCTCGAGGTCTGTCCCTTAGACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001306.3-630s21c1
Sequence:CCGGTGGTCGGCCAACACCATTATCCTCGAGGATAATGGTGTTGGCCGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001306
CLDN3 MISSION shRNA Lentiviral Transduction Particles
claudin 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001306.2-308s1c1
Sequence:CCGGCAACATCATCACGTCGCAGAACTCGAGTTCTGCGACGTGATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001306.2-614s1c1
Sequence:CCGGCAACACCATTATCCGGGACTTCTCGAGAAGTCCCGGATAATGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001306.2-1073s1c1
Sequence:CCGGCCAACCTGCATGGACTGTGAACTCGAGTTCACAGTCCATGCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001306.2-254s1c1
Sequence:CCGGCACCATCGTGTGCTGCGCGTTCTCGAGAACGCGCAGCACACGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001306.3-873s21c1
Sequence:CCGGGACTACGTCTAAGGGACAGACCTCGAGGTCTGTCCCTTAGACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001306.3-630s21c1
Sequence:CCGGTGGTCGGCCAACACCATTATCCTCGAGGATAATGGTGTTGGCCGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks