EMAIL THIS PAGE TO A FRIEND

CLDN4

claudin 4

137 Gene Product Result for
Synonyms: CPE-R CPER CPETR CPETR1 WBSCR8 hCPE-R
UniProtKB ID: O14493
Gene ID:
Human(1364) Summary: This gene encodes an integral membrane protein, which belongs to the claudin family. The protein is a component of tight junction strands and may play a role in internal organ development and function during pre- and postnatal life. This gene is deleted in Williams-Beuren syndrome, a neurodevelopmental disorder affecting multiple systems. [provided by RefSeq, Jul 2008]
Mouse(12740) claudin 4
Rat(304407) claudin 4
chicken(395144) claudin 4
cow(414921) claudin 4
dog(489802) claudin 4
sheep(780477) claudin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001305 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001305 Rosetta Predictions human pricing
NM_001012022 Rosetta Predictions rat pricing
XM_347343 Rosetta Predictions rat pricing
NM_009903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189578 predicted 465
2 SASI_Hs01_00189579 predicted 1460
3 SASI_Hs01_00189580 predicted 907
4 SASI_Hs01_00189581 predicted 1255
5 SASI_Hs01_00189582 predicted 1329
6 SASI_Hs01_00189583 predicted 1462
7 SASI_Hs01_00189584 predicted 1284
8 SASI_Hs01_00189585 predicted 958
9 SASI_Hs01_00189586 predicted 1353
10 SASI_Hs01_00189587 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060732 predicted 1188
2 SASI_Rn01_00060733 predicted 1125
3 SASI_Rn01_00060734 predicted 792
4 SASI_Rn02_00200108 predicted 832
5 SASI_Rn01_00060735 predicted 1082
6 SASI_Rn01_00060736 predicted 1249
7 SASI_Rn01_00060737 predicted 614
8 SASI_Rn01_00060738 predicted 1223
9 SASI_Rn01_00060739 predicted 928
10 SASI_Rn01_00060740 predicted 940
11 SASI_Rn01_00060741 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185184 predicted 1198
2 SASI_Rn01_00185185 predicted 1138
3 SASI_Rn01_00185186 predicted 800
4 SASI_Rn01_00185187 predicted 1094
5 SASI_Rn01_00185188 predicted 1259
6 SASI_Rn01_00185189 predicted 621
7 SASI_Rn01_00185190 predicted 1236
8 SASI_Rn01_00185191 predicted 940
9 SASI_Rn01_00185192 predicted 947
10 SASI_Rn01_00185193 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142458 predicted 427
2 SASI_Mm02_00317408 predicted 940
3 SASI_Mm01_00142460 predicted 1207
4 SASI_Mm02_00317409 predicted 1034
5 SASI_Mm02_00317410 predicted 827
6 SASI_Mm02_00317411 predicted 830
7 SASI_Mm01_00142465 predicted 494
8 SASI_Mm02_00317412 predicted 762
9 SASI_Mm02_00317413 predicted 995
10 SASI_Mm02_00317414 predicted 983
11 SASI_Mm01_00142459 predicted 1123
12 SASI_Mm01_00142461 predicted 586
13 SASI_Mm01_00142462 predicted 1138
14 SASI_Mm01_00142463 predicted 1132
15 SASI_Mm01_00142464 predicted 502
16 SASI_Mm01_00142466 predicted 550
17 SASI_Mm01_00142467 predicted 1161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001305
CLDN4 MISSION shRNA Bacterial Glycerol Stock
claudin 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001305.3-1185s21c1
Sequence:CCGGTCCACCCTCCTCTGGATATTGCTCGAGCAATATCCAGAGGAGGGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001305.3-1266s21c1
Sequence:CCGGGATAGCTTAACCCTGACTTTGCTCGAGCAAAGTCAGGGTTAAGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001305.3-729s21c1
Sequence:CCGGTATGGTGATAGTGCCGGTGTCCTCGAGGACACCGGCACTATCACCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001305.3-1464s1c1
Sequence:CCGGGCAGAGTGGATGGACGGGTTTCTCGAGAAACCCGTCCATCCACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-582s1c1
Sequence:CCGGCGCCCTCGTCATCATCAGCATCTCGAGATGCTGATGATGACGAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-759s1c1
Sequence:CCGGCCACAACATCATCCAAGACTTCTCGAGAAGTCTTGGATGATGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-452s1c1
Sequence:CCGGGCAACATTGTCACCTCGCAGACTCGAGTCTGCGAGGTGACAATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-923s1c1
Sequence:CCGGCCAAGTATTCTGCTGCCCGCTCTCGAGAGCGGGCAGCAGAATACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001305
CLDN4 MISSION shRNA shRNA Plasmid DNA
claudin 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001305.3-1185s21c1
Sequence:CCGGTCCACCCTCCTCTGGATATTGCTCGAGCAATATCCAGAGGAGGGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001305.3-1266s21c1
Sequence:CCGGGATAGCTTAACCCTGACTTTGCTCGAGCAAAGTCAGGGTTAAGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001305.3-729s21c1
Sequence:CCGGTATGGTGATAGTGCCGGTGTCCTCGAGGACACCGGCACTATCACCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001305.3-1464s1c1
Sequence:CCGGGCAGAGTGGATGGACGGGTTTCTCGAGAAACCCGTCCATCCACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-582s1c1
Sequence:CCGGCGCCCTCGTCATCATCAGCATCTCGAGATGCTGATGATGACGAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-759s1c1
Sequence:CCGGCCACAACATCATCCAAGACTTCTCGAGAAGTCTTGGATGATGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-452s1c1
Sequence:CCGGGCAACATTGTCACCTCGCAGACTCGAGTCTGCGAGGTGACAATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-923s1c1
Sequence:CCGGCCAAGTATTCTGCTGCCCGCTCTCGAGAGCGGGCAGCAGAATACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001305
CLDN4 MISSION shRNA Lentiviral Transduction Particles
claudin 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001305.3-1185s21c1
Sequence:CCGGTCCACCCTCCTCTGGATATTGCTCGAGCAATATCCAGAGGAGGGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001305.3-1266s21c1
Sequence:CCGGGATAGCTTAACCCTGACTTTGCTCGAGCAAAGTCAGGGTTAAGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001305.3-729s21c1
Sequence:CCGGTATGGTGATAGTGCCGGTGTCCTCGAGGACACCGGCACTATCACCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001305.3-1464s1c1
Sequence:CCGGGCAGAGTGGATGGACGGGTTTCTCGAGAAACCCGTCCATCCACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-582s1c1
Sequence:CCGGCGCCCTCGTCATCATCAGCATCTCGAGATGCTGATGATGACGAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-759s1c1
Sequence:CCGGCCACAACATCATCCAAGACTTCTCGAGAAGTCTTGGATGATGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-452s1c1
Sequence:CCGGGCAACATTGTCACCTCGCAGACTCGAGTCTGCGAGGTGACAATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001305.3-923s1c1
Sequence:CCGGCCAAGTATTCTGCTGCCCGCTCTCGAGAGCGGGCAGCAGAATACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009903
CLDN4 MISSION shRNA Bacterial Glycerol Stock
claudin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-602s1c1
Sequence:CCGGCCGCGACTTCTACAACCCTATCTCGAGATAGGGTTGTAGAAGTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-548s1c1
Sequence:CCGGCGTGGCAAGCATGCTGATTATCTCGAGATAATCAGCATGCTTGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-416s1c1
Sequence:CCGGCCTTATGGTCATCAGCATCATCTCGAGATGATGCTGATGACCATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009903.1-1376s1c1
Sequence:CCGGCCCTACTAATGAATTTCTGTACTCGAGTACAGAAATTCATTAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-725s1c1
Sequence:CCGGCCCACCTCGTAGCAACGACAACTCGAGTTGTCGTTGCTACGAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009903
CLDN4 MISSION shRNA shRNA Plasmid DNA
claudin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-602s1c1
Sequence:CCGGCCGCGACTTCTACAACCCTATCTCGAGATAGGGTTGTAGAAGTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-548s1c1
Sequence:CCGGCGTGGCAAGCATGCTGATTATCTCGAGATAATCAGCATGCTTGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-416s1c1
Sequence:CCGGCCTTATGGTCATCAGCATCATCTCGAGATGATGCTGATGACCATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009903.1-1376s1c1
Sequence:CCGGCCCTACTAATGAATTTCTGTACTCGAGTACAGAAATTCATTAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-725s1c1
Sequence:CCGGCCCACCTCGTAGCAACGACAACTCGAGTTGTCGTTGCTACGAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009903
CLDN4 MISSION shRNA Lentiviral Transduction Particles
claudin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-602s1c1
Sequence:CCGGCCGCGACTTCTACAACCCTATCTCGAGATAGGGTTGTAGAAGTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-548s1c1
Sequence:CCGGCGTGGCAAGCATGCTGATTATCTCGAGATAATCAGCATGCTTGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-416s1c1
Sequence:CCGGCCTTATGGTCATCAGCATCATCTCGAGATGATGCTGATGACCATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009903.1-1376s1c1
Sequence:CCGGCCCTACTAATGAATTTCTGTACTCGAGTACAGAAATTCATTAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009903.1-725s1c1
Sequence:CCGGCCCACCTCGTAGCAACGACAACTCGAGTTGTCGTTGCTACGAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)