EMAIL THIS PAGE TO A FRIEND

CLDN5

claudin 5

49 Gene Product Result for
Synonyms: AWAL BEC1 CPETRL1 TMVCF
UniProtKB ID: O00501, B3KS11, Q53XW2, Q8WUW3
Gene ID:
Human(7122) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets. Mutations in this gene have been found in patients with velocardiofacial syndrome. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(12741) claudin 5
Rat(65131) claudin 5
chicken(374028) claudin 5
cow(617453) claudin 5
dog(486420) claudin 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003277 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123751 MISSION® esiRNA esiRNA human CLDN5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003277 Rosetta Predictions human pricing
NM_031701 Rosetta Predictions rat pricing
NM_013805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236291 predicted 645
2 SASI_Hs01_00236292 predicted 880
3 SASI_Hs01_00236293 predicted 871
4 SASI_Hs01_00236294 predicted 867
5 SASI_Hs01_00236295 predicted 1343
6 SASI_Hs01_00236296 predicted 1328
7 SASI_Hs01_00236297 predicted 1396
8 SASI_Hs02_00335340 predicted 1331
9 SASI_Hs01_00236298 predicted 890
10 SASI_Hs01_00236299 predicted 912
11 SASI_Hs01_00236300 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065815 predicted 539
2 SASI_Rn01_00065816 predicted 544
3 SASI_Rn01_00065817 predicted 318
4 SASI_Rn01_00065818 predicted 752
5 SASI_Rn01_00065819 predicted 1100
6 SASI_Rn01_00065820 predicted 378
7 SASI_Rn01_00065821 predicted 822
8 SASI_Rn01_00065822 predicted 1094
9 SASI_Rn01_00065823 predicted 1105
10 SASI_Rn02_00265056 predicted 553
11 SASI_Rn01_00065814 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046326 predicted 1053
2 SASI_Mm01_00046327 predicted 1052
3 SASI_Mm01_00046328 predicted 476
4 SASI_Mm01_00046329 predicted 1156
5 SASI_Mm01_00046330 predicted 559
6 SASI_Mm01_00046331 predicted 1093
7 SASI_Mm01_00046332 predicted 389
8 SASI_Mm01_00046333 predicted 344
9 SASI_Mm01_00046334 predicted 1126
10 SASI_Mm01_00046335 predicted 1085
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013805
CLDN5 MISSION shRNA Bacterial Glycerol Stock
claudin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013805.2-1061s1c1
Sequence:CCGGCGCTCAGATTTCATCGGTGAACTCGAGTTCACCGATGAAATCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-555s1c1
Sequence:CCGGGCTCTGCTGGTTCGCCAACATCTCGAGATGTTGGCGAACCAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-428s1c1
Sequence:CCGGTGGCACTCTTTGTTACCTTGACTCGAGTCAAGGTAACAAAGAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-777s1c1
Sequence:CCGGTGGCGATTACGACAAGAAGAACTCGAGTTCTTCTTGTCGTAATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-774s1c1
Sequence:CCGGCAATGGCGATTACGACAAGAACTCGAGTTCTTGTCGTAATCGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013805
CLDN5 MISSION shRNA shRNA Plasmid DNA
claudin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013805.2-1061s1c1
Sequence:CCGGCGCTCAGATTTCATCGGTGAACTCGAGTTCACCGATGAAATCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-555s1c1
Sequence:CCGGGCTCTGCTGGTTCGCCAACATCTCGAGATGTTGGCGAACCAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-428s1c1
Sequence:CCGGTGGCACTCTTTGTTACCTTGACTCGAGTCAAGGTAACAAAGAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-777s1c1
Sequence:CCGGTGGCGATTACGACAAGAAGAACTCGAGTTCTTCTTGTCGTAATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-774s1c1
Sequence:CCGGCAATGGCGATTACGACAAGAACTCGAGTTCTTGTCGTAATCGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013805
CLDN5 MISSION shRNA Lentiviral Transduction Particles
claudin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013805.2-1061s1c1
Sequence:CCGGCGCTCAGATTTCATCGGTGAACTCGAGTTCACCGATGAAATCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-555s1c1
Sequence:CCGGGCTCTGCTGGTTCGCCAACATCTCGAGATGTTGGCGAACCAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-428s1c1
Sequence:CCGGTGGCACTCTTTGTTACCTTGACTCGAGTCAAGGTAACAAAGAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-777s1c1
Sequence:CCGGTGGCGATTACGACAAGAAGAACTCGAGTTCTTCTTGTCGTAATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013805.2-774s1c1
Sequence:CCGGCAATGGCGATTACGACAAGAACTCGAGTTCTTGTCGTAATCGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003277
CLDN5 MISSION shRNA Bacterial Glycerol Stock
claudin 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003277.2-1335s1c1
Sequence:CCGGGCCCTTAACAGACGGAATGAACTCGAGTTCATTCCGTCTGTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003277.2-1100s1c1
Sequence:CCGGCGACTACGACAAGAAGAACTACTCGAGTAGTTCTTCTTGTCGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003277.2-876s1c1
Sequence:CCGGCTCTGCTGGTTCGCCAACATTCTCGAGAATGTTGGCGAACCAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003277.2-581s1c1
Sequence:CCGGCCACAACATCGTGACGGCGCACTCGAGTGCGCCGTCACGATGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-650s21c1
Sequence:CCGGGCACATGCAGTGCAAAGTGTACTCGAGTACACTTTGCACTGCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-743s21c1
Sequence:CCGGGTTCGTTGCGCTCTTCGTGACCTCGAGGTCACGAAGAGCGCAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-930s21c1
Sequence:CCGGGTGTCGCAGAAGTACGAGCTGCTCGAGCAGCTCGTACTTCTGCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-831s21c1
Sequence:CCGGGGAGGCGTGCTCTACCTGTTTCTCGAGAAACAGGTAGAGCACGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003277.2-1521s21c1
Sequence:CCGGGATGTGTACAGCTGGTCTTTACTCGAGTAAAGACCAGCTGTACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003277
CLDN5 MISSION shRNA shRNA Plasmid DNA
claudin 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003277.2-1335s1c1
Sequence:CCGGGCCCTTAACAGACGGAATGAACTCGAGTTCATTCCGTCTGTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003277.2-1100s1c1
Sequence:CCGGCGACTACGACAAGAAGAACTACTCGAGTAGTTCTTCTTGTCGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003277.2-876s1c1
Sequence:CCGGCTCTGCTGGTTCGCCAACATTCTCGAGAATGTTGGCGAACCAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003277.2-581s1c1
Sequence:CCGGCCACAACATCGTGACGGCGCACTCGAGTGCGCCGTCACGATGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-650s21c1
Sequence:CCGGGCACATGCAGTGCAAAGTGTACTCGAGTACACTTTGCACTGCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-743s21c1
Sequence:CCGGGTTCGTTGCGCTCTTCGTGACCTCGAGGTCACGAAGAGCGCAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-930s21c1
Sequence:CCGGGTGTCGCAGAAGTACGAGCTGCTCGAGCAGCTCGTACTTCTGCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-831s21c1
Sequence:CCGGGGAGGCGTGCTCTACCTGTTTCTCGAGAAACAGGTAGAGCACGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003277.2-1521s21c1
Sequence:CCGGGATGTGTACAGCTGGTCTTTACTCGAGTAAAGACCAGCTGTACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003277
CLDN5 MISSION shRNA Lentiviral Transduction Particles
claudin 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003277.2-1335s1c1
Sequence:CCGGGCCCTTAACAGACGGAATGAACTCGAGTTCATTCCGTCTGTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003277.2-1100s1c1
Sequence:CCGGCGACTACGACAAGAAGAACTACTCGAGTAGTTCTTCTTGTCGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003277.2-876s1c1
Sequence:CCGGCTCTGCTGGTTCGCCAACATTCTCGAGAATGTTGGCGAACCAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003277.2-581s1c1
Sequence:CCGGCCACAACATCGTGACGGCGCACTCGAGTGCGCCGTCACGATGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-650s21c1
Sequence:CCGGGCACATGCAGTGCAAAGTGTACTCGAGTACACTTTGCACTGCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-743s21c1
Sequence:CCGGGTTCGTTGCGCTCTTCGTGACCTCGAGGTCACGAAGAGCGCAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-930s21c1
Sequence:CCGGGTGTCGCAGAAGTACGAGCTGCTCGAGCAGCTCGTACTTCTGCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003277.2-831s21c1
Sequence:CCGGGGAGGCGTGCTCTACCTGTTTCTCGAGAAACAGGTAGAGCACGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003277.2-1521s21c1
Sequence:CCGGGATGTGTACAGCTGGTCTTTACTCGAGTAAAGACCAGCTGTACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks