EMAIL THIS PAGE TO A FRIEND

CLDN6

claudin 6

UniProtKB ID: P56747, B3KQP9, D3DUA5
Gene ID:
Human(9074) Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. This gene encodes a component of tight junction strands, which is a member of the claudin family. The protein is an integral membrane protein and is one of the entry cofactors for hepatitis C virus. The gene methylation may be involved in esophageal tumorigenesis. This gene is adjacent to another family member CLDN9 on chromosome 16.[provided by RefSeq, Aug 2010]
Mouse(54419) claudin 6
Rat(287098) claudin 6
dog(490048) claudin 6
cow(511318) claudin 6
sheep(101117294) claudin 6
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021195 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021195 Rosetta Predictions human pricing
NM_001102364 Rosetta Predictions rat pricing
NM_018777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190867 predicted 985
2 SASI_Hs02_00354777 predicted 906
3 SASI_Hs01_00190868 predicted 912
4 SASI_Hs02_00354778 predicted 871
5 SASI_Hs02_00354779 predicted 1021
6 SASI_Hs02_00354780 predicted 973
7 SASI_Hs01_00190866 predicted 422
8 SASI_Hs01_00190869 predicted 807
9 SASI_Hs01_00190870 predicted 893
10 SASI_Hs01_00190871 predicted 692
11 SASI_Hs01_00190872 predicted 916
12 SASI_Hs01_00190873 predicted 764
13 SASI_Hs01_00190874 predicted 851
14 SASI_Hs01_00190875 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211404 predicted 396
2 SASI_Rn02_00211405 predicted 704
3 SASI_Rn02_00211406 predicted 1283
4 SASI_Rn02_00211407 predicted 525
5 SASI_Rn02_00211408 predicted 579
6 SASI_Rn02_00211409 predicted 443
7 SASI_Rn02_00211410 predicted 801
8 SASI_Rn02_00211411 predicted 485
9 SASI_Rn02_00211412 predicted 432
10 SASI_Rn02_00211413 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044094 predicted 1230
2 SASI_Mm01_00044095 predicted 482
3 SASI_Mm01_00044096 predicted 427
4 SASI_Mm01_00044097 predicted 958
5 SASI_Mm01_00044098 predicted 827
6 SASI_Mm01_00044099 predicted 305
7 SASI_Mm01_00044100 predicted 539
8 SASI_Mm01_00044101 predicted 753
9 SASI_Mm01_00044102 predicted 425
10 SASI_Mm01_00044103 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018777
CLDN6 MISSION shRNA Bacterial Glycerol Stock
claudin 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018777.3-572s21c1
Sequence:CCGGCCTTGGTGGCTGATGCTCAAACTCGAGTTTGAGCATCAGCCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018777.3-757s21c1
Sequence:CCGGGAATATCCCACCAAGAATTATCTCGAGATAATTCTTGGTGGGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018777.3-838s21c1
Sequence:CCGGGAAAGGTTACGGAGTAGTTTGCTCGAGCAAACTACTCCGTAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018777.3-1130s21c1
Sequence:CCGGACTTGAGTTTCTGCGTCATTACTCGAGTAATGACGCAGAAACTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018777.2-1083s1c1
Sequence:CCGGGCTGCTGGCATTTCTCACTTTCTCGAGAAAGTGAGAAATGCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-435s1c1
Sequence:CCGGGCACTACCTGTGTGGAAGATACTCGAGTATCTTCCACACAGGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-703s1c1
Sequence:CCGGCAGACATTACATGGCCTGCTACTCGAGTAGCAGGCCATGTAATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-315s1c1
Sequence:CCGGGCAAGGTGTATGACTCACTGTCTCGAGACAGTGAGTCATACACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-544s1c1
Sequence:CCGGCCACTCTATCATCCAGGACTTCTCGAGAAGTCCTGGATGATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018777
CLDN6 MISSION shRNA shRNA Plasmid DNA
claudin 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018777.3-572s21c1
Sequence:CCGGCCTTGGTGGCTGATGCTCAAACTCGAGTTTGAGCATCAGCCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018777.3-757s21c1
Sequence:CCGGGAATATCCCACCAAGAATTATCTCGAGATAATTCTTGGTGGGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018777.3-838s21c1
Sequence:CCGGGAAAGGTTACGGAGTAGTTTGCTCGAGCAAACTACTCCGTAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018777.3-1130s21c1
Sequence:CCGGACTTGAGTTTCTGCGTCATTACTCGAGTAATGACGCAGAAACTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018777.2-1083s1c1
Sequence:CCGGGCTGCTGGCATTTCTCACTTTCTCGAGAAAGTGAGAAATGCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-435s1c1
Sequence:CCGGGCACTACCTGTGTGGAAGATACTCGAGTATCTTCCACACAGGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-703s1c1
Sequence:CCGGCAGACATTACATGGCCTGCTACTCGAGTAGCAGGCCATGTAATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-315s1c1
Sequence:CCGGGCAAGGTGTATGACTCACTGTCTCGAGACAGTGAGTCATACACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-544s1c1
Sequence:CCGGCCACTCTATCATCCAGGACTTCTCGAGAAGTCCTGGATGATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018777
CLDN6 MISSION shRNA Lentiviral Transduction Particles
claudin 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018777.3-572s21c1
Sequence:CCGGCCTTGGTGGCTGATGCTCAAACTCGAGTTTGAGCATCAGCCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018777.3-757s21c1
Sequence:CCGGGAATATCCCACCAAGAATTATCTCGAGATAATTCTTGGTGGGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018777.3-838s21c1
Sequence:CCGGGAAAGGTTACGGAGTAGTTTGCTCGAGCAAACTACTCCGTAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018777.3-1130s21c1
Sequence:CCGGACTTGAGTTTCTGCGTCATTACTCGAGTAATGACGCAGAAACTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018777.2-1083s1c1
Sequence:CCGGGCTGCTGGCATTTCTCACTTTCTCGAGAAAGTGAGAAATGCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-435s1c1
Sequence:CCGGGCACTACCTGTGTGGAAGATACTCGAGTATCTTCCACACAGGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-703s1c1
Sequence:CCGGCAGACATTACATGGCCTGCTACTCGAGTAGCAGGCCATGTAATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-315s1c1
Sequence:CCGGGCAAGGTGTATGACTCACTGTCTCGAGACAGTGAGTCATACACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018777.2-544s1c1
Sequence:CCGGCCACTCTATCATCCAGGACTTCTCGAGAAGTCCTGGATGATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021195
CLDN6 MISSION shRNA Bacterial Glycerol Stock
claudin 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021195.4-1022s21c1
Sequence:CCGGTGTGCTGGCTTTGCAACAAGACTCGAGTCTTGTTGCAAAGCCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021195.4-1160s21c1
Sequence:CCGGACAAATGATCTGTTAACAAAGCTCGAGCTTTGTTAACAGATCATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021195.4-947s21c1
Sequence:CCGGCTTTGAGATTCTGGATCTTGACTCGAGTCAAGATCCAGAATCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021195.3-946s1c1
Sequence:CCGGCCCATCTTAGAAGCCAGTCAACTCGAGTTGACTGGCTTCTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-670s1c1
Sequence:CCGGTGAGTACCCTACCAAGAATTACTCGAGTAATTCTTGGTAGGGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-307s1c1
Sequence:CCGGCCTGTTCGGCTTGCTGGTCTACTCGAGTAGACCAGCAAGCCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-394s1c1
Sequence:CCGGCTCTGGGATTGTCTTTGTCATCTCGAGATGACAAAGACAATCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-460s1c1
Sequence:CCGGCGTCATCCGGGACTTCTATAACTCGAGTTATAGAAGTCCCGGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021195
CLDN6 MISSION shRNA shRNA Plasmid DNA
claudin 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021195.4-1022s21c1
Sequence:CCGGTGTGCTGGCTTTGCAACAAGACTCGAGTCTTGTTGCAAAGCCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021195.4-1160s21c1
Sequence:CCGGACAAATGATCTGTTAACAAAGCTCGAGCTTTGTTAACAGATCATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021195.4-947s21c1
Sequence:CCGGCTTTGAGATTCTGGATCTTGACTCGAGTCAAGATCCAGAATCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021195.3-946s1c1
Sequence:CCGGCCCATCTTAGAAGCCAGTCAACTCGAGTTGACTGGCTTCTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-670s1c1
Sequence:CCGGTGAGTACCCTACCAAGAATTACTCGAGTAATTCTTGGTAGGGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-307s1c1
Sequence:CCGGCCTGTTCGGCTTGCTGGTCTACTCGAGTAGACCAGCAAGCCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-394s1c1
Sequence:CCGGCTCTGGGATTGTCTTTGTCATCTCGAGATGACAAAGACAATCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-460s1c1
Sequence:CCGGCGTCATCCGGGACTTCTATAACTCGAGTTATAGAAGTCCCGGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021195
CLDN6 MISSION shRNA Lentiviral Transduction Particles
claudin 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021195.4-1022s21c1
Sequence:CCGGTGTGCTGGCTTTGCAACAAGACTCGAGTCTTGTTGCAAAGCCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021195.4-1160s21c1
Sequence:CCGGACAAATGATCTGTTAACAAAGCTCGAGCTTTGTTAACAGATCATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021195.4-947s21c1
Sequence:CCGGCTTTGAGATTCTGGATCTTGACTCGAGTCAAGATCCAGAATCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021195.3-946s1c1
Sequence:CCGGCCCATCTTAGAAGCCAGTCAACTCGAGTTGACTGGCTTCTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-670s1c1
Sequence:CCGGTGAGTACCCTACCAAGAATTACTCGAGTAATTCTTGGTAGGGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-307s1c1
Sequence:CCGGCCTGTTCGGCTTGCTGGTCTACTCGAGTAGACCAGCAAGCCGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-394s1c1
Sequence:CCGGCTCTGGGATTGTCTTTGTCATCTCGAGATGACAAAGACAATCCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021195.3-460s1c1
Sequence:CCGGCGTCATCCGGGACTTCTATAACTCGAGTTATAGAAGTCCCGGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks