EMAIL THIS PAGE TO A FRIEND

CLDN8

claudin 8

49 Gene Product Result for
UniProtKB ID: P56748, D3DSE3, Q53EX7
Gene ID:
Human(9073) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein plays important roles in the paracellular cation barrier of the distal renal tubule, and in the paracellular barrier to prevent sodium back-leakage in distal colon. Differential expression of this gene has been observed in colorectal carcinoma and renal cell tumors, and along with claudin-7, is an immunohistochemical marker for the differential diagnosis of chromophobe renal cell carcinoma and renal oncocytoma.[provided by RefSeq, May 2010]
Mouse(54420) claudin 8
Rat(304124) claudin 8
Zebrafish(445278) claudin 8
chicken(427974) claudin 8
dog(478401) claudin 8
cow(538761) claudin 8
sheep(101106811) claudin 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199328 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037051 MISSION® esiRNA esiRNA human CLDN8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199328 Rosetta Predictions human pricing
NM_001037774 Rosetta Predictions rat pricing
NM_018778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090843 predicted 984
2 SASI_Hs01_00090844 predicted 846
3 SASI_Hs01_00090845 predicted 918
4 SASI_Hs01_00090846 predicted 932
5 SASI_Hs01_00090847 predicted 945
6 SASI_Hs01_00090848 predicted 223
7 SASI_Hs01_00090849 predicted 723
8 SASI_Hs01_00090851 predicted 1024
9 SASI_Hs01_00090852 predicted 665
10 SASI_Hs02_00372744 predicted 735
11 SASI_Hs01_00090850 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072906 predicted 1079
2 SASI_Rn01_00072907 predicted 1034
3 SASI_Rn01_00072908 predicted 936
4 SASI_Rn02_00204569 predicted 986
5 SASI_Rn01_00072909 predicted 950
6 SASI_Rn01_00072910 predicted 570
7 SASI_Rn01_00072911 predicted 885
8 SASI_Rn01_00072912 predicted 759
9 SASI_Rn01_00072913 predicted 851
10 SASI_Rn01_00072914 predicted 579
11 SASI_Rn01_00072915 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093393 predicted 1078
2 SASI_Mm01_00093394 predicted 1114
3 SASI_Mm01_00093395 predicted 719
4 SASI_Mm01_00093396 predicted 569
5 SASI_Mm01_00093397 predicted 951
6 SASI_Mm01_00093398 predicted 903
7 SASI_Mm01_00093399 predicted 945
8 SASI_Mm01_00093400 predicted 993
9 SASI_Mm01_00093401 predicted 865
10 SASI_Mm01_00093402 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199328
CLDN8 MISSION shRNA Bacterial Glycerol Stock
claudin 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199328.1-276s21c1
Sequence:CCGGTGATTCCCTGCTGGCTCTTTCCTCGAGGAAAGAGCCAGCAGGGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199328.1-1214s21c1
Sequence:CCGGGGGTTGAAGAAGGTTACTATTCTCGAGAATAGTAACCTTCTTCAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199328.1-1056s21c1
Sequence:CCGGTGTAATTTCTCCACGACATAGCTCGAGCTATGTCGTGGAGAAATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199328.1-1154s1c1
Sequence:CCGGCCAGTCCATTACACTGAATAACTCGAGTTATTCAGTGTAATGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-527s1c1
Sequence:CCGGCAATAGTGAATGTTGCCCAAACTCGAGTTTGGGCAACATTCACTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-726s1c1
Sequence:CCGGCGTCTACTCCAGAAGTCAGTACTCGAGTACTGACTTCTGGAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-656s1c1
Sequence:CCGGGCTACAGATACTCGATACCTTCTCGAGAAGGTATCGAGTATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-355s1c1
Sequence:CCGGGCTTTCATGATGGCCATCCTTCTCGAGAAGGATGGCCATCATGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199328
CLDN8 MISSION shRNA shRNA Plasmid DNA
claudin 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199328.1-276s21c1
Sequence:CCGGTGATTCCCTGCTGGCTCTTTCCTCGAGGAAAGAGCCAGCAGGGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199328.1-1214s21c1
Sequence:CCGGGGGTTGAAGAAGGTTACTATTCTCGAGAATAGTAACCTTCTTCAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199328.1-1056s21c1
Sequence:CCGGTGTAATTTCTCCACGACATAGCTCGAGCTATGTCGTGGAGAAATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199328.1-1154s1c1
Sequence:CCGGCCAGTCCATTACACTGAATAACTCGAGTTATTCAGTGTAATGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-527s1c1
Sequence:CCGGCAATAGTGAATGTTGCCCAAACTCGAGTTTGGGCAACATTCACTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-726s1c1
Sequence:CCGGCGTCTACTCCAGAAGTCAGTACTCGAGTACTGACTTCTGGAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-656s1c1
Sequence:CCGGGCTACAGATACTCGATACCTTCTCGAGAAGGTATCGAGTATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-355s1c1
Sequence:CCGGGCTTTCATGATGGCCATCCTTCTCGAGAAGGATGGCCATCATGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199328
CLDN8 MISSION shRNA Lentiviral Transduction Particles
claudin 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199328.1-276s21c1
Sequence:CCGGTGATTCCCTGCTGGCTCTTTCCTCGAGGAAAGAGCCAGCAGGGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199328.1-1214s21c1
Sequence:CCGGGGGTTGAAGAAGGTTACTATTCTCGAGAATAGTAACCTTCTTCAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199328.1-1056s21c1
Sequence:CCGGTGTAATTTCTCCACGACATAGCTCGAGCTATGTCGTGGAGAAATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199328.1-1154s1c1
Sequence:CCGGCCAGTCCATTACACTGAATAACTCGAGTTATTCAGTGTAATGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-527s1c1
Sequence:CCGGCAATAGTGAATGTTGCCCAAACTCGAGTTTGGGCAACATTCACTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-726s1c1
Sequence:CCGGCGTCTACTCCAGAAGTCAGTACTCGAGTACTGACTTCTGGAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-656s1c1
Sequence:CCGGGCTACAGATACTCGATACCTTCTCGAGAAGGTATCGAGTATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199328.1-355s1c1
Sequence:CCGGGCTTTCATGATGGCCATCCTTCTCGAGAAGGATGGCCATCATGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018778
CLDN8 MISSION shRNA Bacterial Glycerol Stock
claudin 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018778.2-1425s1c1
Sequence:CCGGGCCTACTATCTCTTAAAGTTTCTCGAGAAACTTTAAGAGATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-200s1c1
Sequence:CCGGGCCTTCATCGAAAGTAACATTCTCGAGAATGTTACTTTCGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-209s1c1
Sequence:CCGGGAAAGTAACATTGTGGTGTTTCTCGAGAAACACCACAATGTTACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-637s1c1
Sequence:CCGGAGCACTGTTCTGTTGTGTGTTCTCGAGAACACACAACAGAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-523s1c1
Sequence:CCGGCAATTCCATCATCAGAGACTTCTCGAGAAGTCTCTGATGATGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018778
CLDN8 MISSION shRNA shRNA Plasmid DNA
claudin 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018778.2-1425s1c1
Sequence:CCGGGCCTACTATCTCTTAAAGTTTCTCGAGAAACTTTAAGAGATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-200s1c1
Sequence:CCGGGCCTTCATCGAAAGTAACATTCTCGAGAATGTTACTTTCGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-209s1c1
Sequence:CCGGGAAAGTAACATTGTGGTGTTTCTCGAGAAACACCACAATGTTACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-637s1c1
Sequence:CCGGAGCACTGTTCTGTTGTGTGTTCTCGAGAACACACAACAGAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-523s1c1
Sequence:CCGGCAATTCCATCATCAGAGACTTCTCGAGAAGTCTCTGATGATGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018778
CLDN8 MISSION shRNA Lentiviral Transduction Particles
claudin 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018778.2-1425s1c1
Sequence:CCGGGCCTACTATCTCTTAAAGTTTCTCGAGAAACTTTAAGAGATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-200s1c1
Sequence:CCGGGCCTTCATCGAAAGTAACATTCTCGAGAATGTTACTTTCGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-209s1c1
Sequence:CCGGGAAAGTAACATTGTGGTGTTTCTCGAGAAACACCACAATGTTACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-637s1c1
Sequence:CCGGAGCACTGTTCTGTTGTGTGTTCTCGAGAACACACAACAGAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018778.2-523s1c1
Sequence:CCGGCAATTCCATCATCAGAGACTTCTCGAGAAGTCTCTGATGATGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks