EMAIL THIS PAGE TO A FRIEND

CLDN9

claudin 9

58 Gene Product Result for
UniProtKB ID: O95484
Gene ID:
Human(9080) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein is one of the entry cofactors for hepatitis C virus. Mouse studies revealed that this gene is required for the preservation of sensory cells in the hearing organ and the gene deficiency is associated with deafness. [provided by RefSeq, Jun 2010]
Mouse(56863) claudin 9
Rat(287099) claudin 9
sheep(101117039) claudin 9
chicken(417474) claudin 9
cow(617449) claudin 9
dog(490049) claudin 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV33617 Anti-CLDN9 antibody produced in rabbit IgG fraction of antiserum canine, mouse, human, guinea pig, pig, rat, horse
western blot pricing
HPA076613 Anti-CLDN9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020982 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219901 MISSION® esiRNA esiRNA targeting human CLDN9 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020982 Rosetta Predictions human pricing
NM_001011889 Rosetta Predictions rat pricing
XM_573053 Rosetta Predictions rat pricing
NM_020293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354432 predicted 1430
2 SASI_Hs01_00128037 predicted 1265
3 SASI_Hs01_00128038 predicted 578
4 SASI_Hs01_00128039 predicted 1269
5 SASI_Hs01_00128040 predicted 882
6 SASI_Hs01_00128041 predicted 1197
7 SASI_Hs01_00128042 predicted 1213
8 SASI_Hs01_00128043 predicted 1182
9 SASI_Hs01_00128044 predicted 581
10 SASI_Hs01_00128045 predicted 902
11 SASI_Hs01_00128046 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066578 predicted 1101
2 SASI_Rn01_00066583 predicted 808
3 SASI_Rn01_00066584 predicted 976
4 SASI_Rn01_00066585 predicted 1145
5 SASI_Rn02_00199862 predicted 805
6 SASI_Rn02_00199863 predicted 399
7 SASI_Rn02_00199864 predicted 1065
8 SASI_Rn02_00199865 predicted 1129
9 SASI_Rn01_00066582 predicted 1104
10 SASI_Rn02_00199866 predicted 361
11 SASI_Rn01_00066579 predicted 1036
12 SASI_Rn01_00066580 predicted 985
13 SASI_Rn01_00066581 predicted 820
14 SASI_Rn01_00066586 predicted 1068
15 SASI_Rn01_00066587 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176629 predicted 404
2 SASI_Rn01_00176630 predicted 406
3 SASI_Rn01_00176631 predicted 370
4 SASI_Rn01_00176632 predicted 397
5 SASI_Rn01_00176633 predicted 390
6 SASI_Rn01_00176634 predicted 378
7 SASI_Rn01_00176635 predicted 402
8 SASI_Rn01_00176636 predicted 433
9 SASI_Rn01_00176637 predicted 1107
10 SASI_Rn01_00176638 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106582 predicted 1066
2 SASI_Mm01_00106583 predicted 479
3 SASI_Mm01_00106584 predicted 789
4 SASI_Mm01_00106585 predicted 988
5 SASI_Mm01_00106586 predicted 980
6 SASI_Mm01_00106587 predicted 1061
7 SASI_Mm01_00106588 predicted 541
8 SASI_Mm01_00106589 predicted 1102
9 SASI_Mm01_00106590 predicted 547
10 SASI_Mm01_00106591 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020293
CLDN9 MISSION shRNA Bacterial Glycerol Stock
claudin 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020293.2-1076s1c1
Sequence:CCGGGCTACATCCTTATATCATCAACTCGAGTTGATGATATAAGGATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-965s1c1
Sequence:CCGGGCTACTCCATCCCTTCCCGTTCTCGAGAACGGGAAGGGATGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-549s1c1
Sequence:CCGGCCAGATGCAGTGCAAAGTATACTCGAGTATACTTTGCACTGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-789s1c1
Sequence:CCGGCCATGCCATCATCCAGGATTTCTCGAGAAATCCTGGATGATGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-558s1c1
Sequence:CCGGGTGCAAAGTATACGACTCACTCTCGAGAGTGAGTCGTATACTTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020293
CLDN9 MISSION shRNA shRNA Plasmid DNA
claudin 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020293.2-1076s1c1
Sequence:CCGGGCTACATCCTTATATCATCAACTCGAGTTGATGATATAAGGATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-965s1c1
Sequence:CCGGGCTACTCCATCCCTTCCCGTTCTCGAGAACGGGAAGGGATGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-549s1c1
Sequence:CCGGCCAGATGCAGTGCAAAGTATACTCGAGTATACTTTGCACTGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-789s1c1
Sequence:CCGGCCATGCCATCATCCAGGATTTCTCGAGAAATCCTGGATGATGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-558s1c1
Sequence:CCGGGTGCAAAGTATACGACTCACTCTCGAGAGTGAGTCGTATACTTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020293
CLDN9 MISSION shRNA Lentiviral Transduction Particles
claudin 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020293.2-1076s1c1
Sequence:CCGGGCTACATCCTTATATCATCAACTCGAGTTGATGATATAAGGATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-965s1c1
Sequence:CCGGGCTACTCCATCCCTTCCCGTTCTCGAGAACGGGAAGGGATGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-549s1c1
Sequence:CCGGCCAGATGCAGTGCAAAGTATACTCGAGTATACTTTGCACTGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-789s1c1
Sequence:CCGGCCATGCCATCATCCAGGATTTCTCGAGAAATCCTGGATGATGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020293.2-558s1c1
Sequence:CCGGGTGCAAAGTATACGACTCACTCTCGAGAGTGAGTCGTATACTTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020982
CLDN9 MISSION shRNA Bacterial Glycerol Stock
claudin 9
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020982.2-1482s1c1
Sequence:CCGGCAGTAATTGTTTCCTTCCGTTCTCGAGAACGGAAGGAAACAATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-1157s1c1
Sequence:CCGGACCTCGGCTGGGCTACTCCATCTCGAGATGGAGTAGCCCAGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-902s1c1
Sequence:CCGGCGAAGGTGCCAAGGCCCGTATCTCGAGATACGGGCCTTGGCACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-865s1c1
Sequence:CCGGCCATCACAGGTGCCCAGTGTACTCGAGTACACTGGGCACCTGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-1189s1c1
Sequence:CCGGCGGGTGCATCTGGACTGGACACTCGAGTGTCCAGTCCAGATGCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020982.3-1223s21c1
Sequence:CCGGACGTGTGTGGAGGACGAAGGTCTCGAGACCTTCGTCCTCCACACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020982
CLDN9 MISSION shRNA shRNA Plasmid DNA
claudin 9
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020982.2-1482s1c1
Sequence:CCGGCAGTAATTGTTTCCTTCCGTTCTCGAGAACGGAAGGAAACAATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-1157s1c1
Sequence:CCGGACCTCGGCTGGGCTACTCCATCTCGAGATGGAGTAGCCCAGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-902s1c1
Sequence:CCGGCGAAGGTGCCAAGGCCCGTATCTCGAGATACGGGCCTTGGCACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-865s1c1
Sequence:CCGGCCATCACAGGTGCCCAGTGTACTCGAGTACACTGGGCACCTGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-1189s1c1
Sequence:CCGGCGGGTGCATCTGGACTGGACACTCGAGTGTCCAGTCCAGATGCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020982.3-1223s21c1
Sequence:CCGGACGTGTGTGGAGGACGAAGGTCTCGAGACCTTCGTCCTCCACACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020982
CLDN9 MISSION shRNA Lentiviral Transduction Particles
claudin 9
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020982.2-1482s1c1
Sequence:CCGGCAGTAATTGTTTCCTTCCGTTCTCGAGAACGGAAGGAAACAATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-1157s1c1
Sequence:CCGGACCTCGGCTGGGCTACTCCATCTCGAGATGGAGTAGCCCAGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-902s1c1
Sequence:CCGGCGAAGGTGCCAAGGCCCGTATCTCGAGATACGGGCCTTGGCACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-865s1c1
Sequence:CCGGCCATCACAGGTGCCCAGTGTACTCGAGTACACTGGGCACCTGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020982.2-1189s1c1
Sequence:CCGGCGGGTGCATCTGGACTGGACACTCGAGTGTCCAGTCCAGATGCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020982.3-1223s21c1
Sequence:CCGGACGTGTGTGGAGGACGAAGGTCTCGAGACCTTCGTCCTCCACACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks