EMAIL THIS PAGE TO A FRIEND

CLDND1

claudin domain containing 1

187 Gene Product Result for
Synonyms: C3orf4 GENX-3745
Gene ID:
Rat(288182) claudin domain containing 1
chicken(418357) claudin domain containing 1
cow(515537) claudin domain containing 1
domestic cat(101090887) claudin domain containing 1
dog(478534) claudin domain containing 1
naked mole-rat(101702810) claudin domain containing 1
domestic guinea pig(100720341) claudin domain containing 1
sheep(101106127) claudin domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019895 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004191 MISSION® esiRNA esiRNA targeting human CLDND1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040181 Rosetta Predictions human pricing
NM_001040182 Rosetta Predictions human pricing
NM_001040183 Rosetta Predictions human pricing
NM_001040184 Rosetta Predictions human pricing
NM_001040199 Rosetta Predictions human pricing
NM_001040200 Rosetta Predictions human pricing
NM_019895 Rosetta Predictions human pricing
NM_001006955 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012704 predicted 1301
2 SASI_Hs01_00012705 predicted 1336
3 SASI_Hs01_00012706 predicted 1378
4 SASI_Hs01_00012707 predicted 1428
5 SASI_Hs01_00012708 predicted 1296
6 SASI_Hs02_00308890 predicted 1359
7 SASI_Hs01_00012709 predicted 1300
8 SASI_Hs01_00012710 predicted 1301
9 SASI_Hs01_00012711 predicted 789
10 SASI_Hs01_00012712 predicted 721
11 SASI_Hs01_00012713 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069965 predicted 1346
2 SASI_Hs01_00069966 predicted 1376
3 SASI_Hs01_00069967 predicted 1420
4 SASI_Hs01_00069968 predicted 1475
5 SASI_Hs01_00069969 predicted 1340
6 SASI_Hs02_00308891 predicted 1399
7 SASI_Hs01_00069970 predicted 1345
8 SASI_Hs01_00069971 predicted 1345
9 SASI_Hs01_00069972 predicted 833
10 SASI_Hs02_00308892 predicted 769
11 SASI_Hs01_00069964 predicted 1533
12 SASI_Hs01_00069973 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222263 predicted 1292
2 SASI_Hs01_00222264 predicted 1330
3 SASI_Hs01_00222265 predicted 1373
4 SASI_Hs01_00222266 predicted 1426
5 SASI_Hs01_00222267 predicted 1295
6 SASI_Hs02_00308893 predicted 1355
7 SASI_Hs01_00222268 predicted 1299
8 SASI_Hs01_00222269 predicted 1294
9 SASI_Hs01_00222270 predicted 780
10 SASI_Hs01_00222271 predicted 719
11 SASI_Hs01_00222272 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246437 predicted 548
2 SASI_Hs01_00246438 predicted 477
3 SASI_Hs01_00246439 predicted 530
4 SASI_Hs01_00246440 predicted 458
5 SASI_Hs01_00246441 predicted 481
6 SASI_Hs01_00246442 predicted 527
7 SASI_Hs01_00246443 predicted 470
8 SASI_Hs01_00246444 predicted 554
9 SASI_Hs01_00246445 predicted 526
10 SASI_Hs01_00246446 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221423 predicted 1792
2 SASI_Hs01_00221424 predicted 1638
3 SASI_Hs01_00221425 predicted 1687
4 SASI_Hs01_00221426 predicted 1735
5 SASI_Hs01_00221427 predicted 1666
6 SASI_Hs01_00221428 predicted 1095
7 SASI_Hs01_00221429 predicted 1033
8 SASI_Hs01_00221430 predicted 1749
9 SASI_Hs01_00221431 predicted 1104
10 SASI_Hs02_00308905 predicted 1073
11 SASI_Hs01_00221422 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114797 predicted 993
2 SASI_Hs01_00114798 predicted 1022
3 SASI_Hs01_00114799 predicted 1065
4 SASI_Hs01_00114800 predicted 1117
5 SASI_Hs01_00114801 predicted 989
6 SASI_Hs02_00308906 predicted 1052
7 SASI_Hs01_00114802 predicted 992
8 SASI_Hs01_00114803 predicted 986
9 SASI_Hs01_00114804 predicted 475
10 SASI_Hs01_00114805 predicted 1131
11 SASI_Hs01_00114796 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197259 predicted 1538
2 SASI_Hs01_00197260 predicted 1386
3 SASI_Hs01_00197261 predicted 1426
4 SASI_Hs01_00197262 predicted 1483
5 SASI_Hs01_00197263 predicted 1408
6 SASI_Hs01_00197264 predicted 840
7 SASI_Hs01_00197265 predicted 774
8 SASI_Hs01_00197266 predicted 1489
9 SASI_Hs01_00197267 predicted 849
10 SASI_Hs02_00352918 predicted 817
11 SASI_Hs01_00197258 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063646 predicted 395
2 SASI_Rn01_00063648 predicted 842
3 SASI_Rn01_00063649 predicted 370
4 SASI_Rn01_00063650 predicted 387
5 SASI_Rn01_00063651 predicted 417
6 SASI_Rn02_00198503 predicted 454
7 SASI_Rn01_00063653 predicted 529
8 SASI_Rn02_00198504 predicted 661
9 SASI_Rn02_00198505 predicted 874
10 SASI_Rn01_00063654 predicted 246
11 SASI_Rn01_00063647 predicted 341
12 SASI_Rn01_00063652 predicted 424
13 SASI_Rn01_00063655 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019895
VALIDATED
CLDND1 MISSION shRNA Bacterial Glycerol Stock
claudin domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-1007s21c1
Sequence:CCGGCCGGAAAGAGTACACCTTAATCTCGAGATTAAGGTGTACTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-1016s21c1
Sequence:CCGGGTACACCTTAATGAAGGCATACTCGAGTATGCCTTCATTAAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-370s21c1
Sequence:CCGGGCACAGACTTCTGGTATGAATCTCGAGATTCATACCAGAAGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-903s21c1
Sequence:CCGGGACAATGTATCCGGTGAATTTCTCGAGAAATTCACCGGATACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019895.2-1493s21c1
Sequence:CCGGCCAGCAGTATTAGTGCTGTTTCTCGAGAAACAGCACTAATACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019895.1-963s1c1
Sequence:CCGGGCACAGACTTCTGGTATGAATCTCGAGATTCATACCAGAAGTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019895.1-1496s1c1
Sequence:CCGGGACAATGTATCCGGTGAATTTCTCGAGAAATTCACCGGATACATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019895.1-1609s1c1
Sequence:CCGGGTACACCTTAATGAAGGCATACTCGAGTATGCCTTCATTAAGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019895.1-2086s1c1
Sequence:CCGGCCAGCAGTATTAGTGCTGTTTCTCGAGAAACAGCACTAATACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019895.1-1600s1c1
Sequence:CCGGCCGGAAAGAGTACACCTTAATCTCGAGATTAAGGTGTACTCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019895
VALIDATED
CLDND1 MISSION shRNA shRNA Plasmid DNA
claudin domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-1007s21c1
Sequence:CCGGCCGGAAAGAGTACACCTTAATCTCGAGATTAAGGTGTACTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-1016s21c1
Sequence:CCGGGTACACCTTAATGAAGGCATACTCGAGTATGCCTTCATTAAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-370s21c1
Sequence:CCGGGCACAGACTTCTGGTATGAATCTCGAGATTCATACCAGAAGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-903s21c1
Sequence:CCGGGACAATGTATCCGGTGAATTTCTCGAGAAATTCACCGGATACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019895.2-1493s21c1
Sequence:CCGGCCAGCAGTATTAGTGCTGTTTCTCGAGAAACAGCACTAATACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019895.1-963s1c1
Sequence:CCGGGCACAGACTTCTGGTATGAATCTCGAGATTCATACCAGAAGTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019895.1-1496s1c1
Sequence:CCGGGACAATGTATCCGGTGAATTTCTCGAGAAATTCACCGGATACATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019895.1-1609s1c1
Sequence:CCGGGTACACCTTAATGAAGGCATACTCGAGTATGCCTTCATTAAGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019895.1-2086s1c1
Sequence:CCGGCCAGCAGTATTAGTGCTGTTTCTCGAGAAACAGCACTAATACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019895.1-1600s1c1
Sequence:CCGGCCGGAAAGAGTACACCTTAATCTCGAGATTAAGGTGTACTCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019895
VALIDATED
CLDND1 MISSION shRNA Lentiviral Transduction Particles
claudin domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-1007s21c1
Sequence:CCGGCCGGAAAGAGTACACCTTAATCTCGAGATTAAGGTGTACTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-1016s21c1
Sequence:CCGGGTACACCTTAATGAAGGCATACTCGAGTATGCCTTCATTAAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-370s21c1
Sequence:CCGGGCACAGACTTCTGGTATGAATCTCGAGATTCATACCAGAAGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019895.2-903s21c1
Sequence:CCGGGACAATGTATCCGGTGAATTTCTCGAGAAATTCACCGGATACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019895.2-1493s21c1
Sequence:CCGGCCAGCAGTATTAGTGCTGTTTCTCGAGAAACAGCACTAATACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019895.1-963s1c1
Sequence:CCGGGCACAGACTTCTGGTATGAATCTCGAGATTCATACCAGAAGTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019895.1-1496s1c1
Sequence:CCGGGACAATGTATCCGGTGAATTTCTCGAGAAATTCACCGGATACATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019895.1-1609s1c1
Sequence:CCGGGTACACCTTAATGAAGGCATACTCGAGTATGCCTTCATTAAGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019895.1-2086s1c1
Sequence:CCGGCCAGCAGTATTAGTGCTGTTTCTCGAGAAACAGCACTAATACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019895.1-1600s1c1
Sequence:CCGGCCGGAAAGAGTACACCTTAATCTCGAGATTAAGGTGTACTCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks