EMAIL THIS PAGE TO A FRIEND

CLDND2

claudin domain containing 2

UniProtKB ID: Q8NHS1
Gene ID:
Mouse(74276) claudin domain containing 2
Rat(499140) claudin domain containing 2
sheep(101122378) claudin domain containing 2
domestic guinea pig(100713730) claudin domain containing 2
naked mole-rat(101710916) claudin domain containing 2
cow(618259) claudin domain containing 2
domestic cat(101091238) claudin domain containing 2
dog(476399) claudin domain containing 2
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152353 Rosetta Predictions human pricing
NM_001109143 Rosetta Predictions rat pricing
NM_028849 Rosetta Predictions mouse pricing
XM_133406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365987 predicted 562
2 SASI_Hs01_00157312 predicted 502
3 SASI_Hs02_00365988 predicted 742
4 SASI_Hs01_00157313 predicted 478
5 SASI_Hs01_00157314 predicted 633
6 SASI_Hs01_00157315 predicted 753
7 SASI_Hs01_00157316 predicted 474
8 SASI_Hs01_00157317 predicted 499
9 SASI_Hs01_00157319 predicted 557
10 SASI_Hs01_00157320 predicted 735
11 SASI_Hs01_00157311 predicted 610
12 SASI_Hs01_00157318 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245550 predicted 376
2 SASI_Rn02_00245551 predicted 199
3 SASI_Rn02_00245552 predicted 357
4 SASI_Rn02_00245553 predicted 513
5 SASI_Rn02_00245554 predicted 510
6 SASI_Rn02_00245555 predicted 365
7 SASI_Rn02_00245556 predicted 277
8 SASI_Rn02_00245557 predicted 439
9 SASI_Rn02_00245558 predicted 229
10 SASI_Rn02_00245559 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334502 predicted 284
2 SASI_Mm02_00334503 predicted 338
3 SASI_Mm02_00334504 predicted 255
4 SASI_Mm02_00334505 predicted 275
5 SASI_Mm02_00334506 predicted 240
6 SASI_Mm02_00334507 predicted 349
7 SASI_Mm02_00334508 predicted 215
8 SASI_Mm02_00334509 predicted 204
9 SASI_Mm02_00334510 predicted 363
10 SASI_Mm02_00334511 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268803 predicted 390
2 SASI_Mm01_00268804 predicted 373
3 SASI_Mm01_00268805 predicted 387
4 SASI_Mm01_00268806 predicted 383
5 SASI_Mm01_00268807 predicted 390
6 SASI_Mm01_00268808 predicted 319
7 SASI_Mm01_00268809 predicted 319
8 SASI_Mm01_00268810 predicted 434
9 SASI_Mm01_00268811 predicted 346
10 SASI_Mm01_00268812 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152353
CLDND2 MISSION shRNA Bacterial Glycerol Stock
claudin domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-792s1c1
Sequence:CCGGCAACGTCTTCTTCTCTTGGTCCTCGAGGACCAAGAGAAGAAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-759s1c1
Sequence:CCGGGATAGGCTACACCGTGAAGAACTCGAGTTCTTCACGGTGTAGCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-771s1c1
Sequence:CCGGCGTGAAGAATGCGTGGAAGAACTCGAGTTCTTCCACGCATTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-796s1c1
Sequence:CCGGGTCTTCTTCTCTTGGTCCTATCTCGAGATAGGACCAAGAGAAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-554s21c1
Sequence:CCGGAGGAATGCAACCACGGCATCTCTCGAGAGATGCCGTGGTTGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-512s21c1
Sequence:CCGGACTACTGGACCCGCCAACAAGCTCGAGCTTGTTGGCGGGTCCAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-895s21c1
Sequence:CCGGACCGACGCCATCAGTGGATTCCTCGAGGAATCCACTGATGGCGTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-747s21c1
Sequence:CCGGGCTGACCGCCTTGATAGGCTACTCGAGTAGCCTATCAAGGCGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152353
CLDND2 MISSION shRNA shRNA Plasmid DNA
claudin domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-792s1c1
Sequence:CCGGCAACGTCTTCTTCTCTTGGTCCTCGAGGACCAAGAGAAGAAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-759s1c1
Sequence:CCGGGATAGGCTACACCGTGAAGAACTCGAGTTCTTCACGGTGTAGCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-771s1c1
Sequence:CCGGCGTGAAGAATGCGTGGAAGAACTCGAGTTCTTCCACGCATTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-796s1c1
Sequence:CCGGGTCTTCTTCTCTTGGTCCTATCTCGAGATAGGACCAAGAGAAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-554s21c1
Sequence:CCGGAGGAATGCAACCACGGCATCTCTCGAGAGATGCCGTGGTTGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-512s21c1
Sequence:CCGGACTACTGGACCCGCCAACAAGCTCGAGCTTGTTGGCGGGTCCAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-895s21c1
Sequence:CCGGACCGACGCCATCAGTGGATTCCTCGAGGAATCCACTGATGGCGTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-747s21c1
Sequence:CCGGGCTGACCGCCTTGATAGGCTACTCGAGTAGCCTATCAAGGCGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152353
CLDND2 MISSION shRNA Lentiviral Transduction Particles
claudin domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-792s1c1
Sequence:CCGGCAACGTCTTCTTCTCTTGGTCCTCGAGGACCAAGAGAAGAAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-759s1c1
Sequence:CCGGGATAGGCTACACCGTGAAGAACTCGAGTTCTTCACGGTGTAGCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-771s1c1
Sequence:CCGGCGTGAAGAATGCGTGGAAGAACTCGAGTTCTTCCACGCATTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152353.1-796s1c1
Sequence:CCGGGTCTTCTTCTCTTGGTCCTATCTCGAGATAGGACCAAGAGAAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-554s21c1
Sequence:CCGGAGGAATGCAACCACGGCATCTCTCGAGAGATGCCGTGGTTGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-512s21c1
Sequence:CCGGACTACTGGACCCGCCAACAAGCTCGAGCTTGTTGGCGGGTCCAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-895s21c1
Sequence:CCGGACCGACGCCATCAGTGGATTCCTCGAGGAATCCACTGATGGCGTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152353.2-747s21c1
Sequence:CCGGGCTGACCGCCTTGATAGGCTACTCGAGTAGCCTATCAAGGCGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028849
CLDND2 MISSION shRNA Bacterial Glycerol Stock
claudin domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-404s21c1
Sequence:CCGGCTGATTGCCTTGGCCGTATACCTCGAGGTATACGGCCAAGGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-284s21c1
Sequence:CCGGTTGGCAGCAACCTTCAGTATTCTCGAGAATACTGAAGGTTGCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-348s21c1
Sequence:CCGGAGTCACGACGTAGCCAGAATACTCGAGTATTCTGGCTACGTCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-108s21c1
Sequence:CCGGCTGGAGGGAATTTACTTAATCCTCGAGGATTAAGTAAATTCCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-210s21c1
Sequence:CCGGAGGAGTGTACCCATGGCAAATCTCGAGATTTGCCATGGGTACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028849
CLDND2 MISSION shRNA shRNA Plasmid DNA
claudin domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-404s21c1
Sequence:CCGGCTGATTGCCTTGGCCGTATACCTCGAGGTATACGGCCAAGGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-284s21c1
Sequence:CCGGTTGGCAGCAACCTTCAGTATTCTCGAGAATACTGAAGGTTGCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-348s21c1
Sequence:CCGGAGTCACGACGTAGCCAGAATACTCGAGTATTCTGGCTACGTCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-108s21c1
Sequence:CCGGCTGGAGGGAATTTACTTAATCCTCGAGGATTAAGTAAATTCCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-210s21c1
Sequence:CCGGAGGAGTGTACCCATGGCAAATCTCGAGATTTGCCATGGGTACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028849
CLDND2 MISSION shRNA Lentiviral Transduction Particles
claudin domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-404s21c1
Sequence:CCGGCTGATTGCCTTGGCCGTATACCTCGAGGTATACGGCCAAGGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-284s21c1
Sequence:CCGGTTGGCAGCAACCTTCAGTATTCTCGAGAATACTGAAGGTTGCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-348s21c1
Sequence:CCGGAGTCACGACGTAGCCAGAATACTCGAGTATTCTGGCTACGTCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-108s21c1
Sequence:CCGGCTGGAGGGAATTTACTTAATCCTCGAGGATTAAGTAAATTCCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028849.1-210s21c1
Sequence:CCGGAGGAGTGTACCCATGGCAAATCTCGAGATTTGCCATGGGTACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks