EMAIL THIS PAGE TO A FRIEND

CLEC10A

C-type lectin domain family 10, member A

57 Gene Product Result for
Synonyms: CD301 CLECSF13 CLECSF14 HML HML2 MGL
UniProtKB ID: Q8IUN9, A8K8J8, Q14538, Q6PIW3
Gene ID:
Human(10462) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may function as a cell surface antigen. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(17312) C-type lectin domain family 10, member A
Rat(64195) C-type lectin domain family 10, member A
cow(514833) C-type lectin domain family 10, member A
dog(607405) C-type lectin domain family 10, member A
sheep(101117600) C-type lectin domain family 10, member A
naked mole-rat(101725332) C-type lectin domain family 10, member A
domestic guinea pig(100714742) C-type lectin domain family 10, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1372 Human CLEC10A ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006344 Rosetta Predictions human pricing
NM_182906 Rosetta Predictions human pricing
NM_022393 Rosetta Predictions rat pricing
NM_010796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085113 predicted 969
2 SASI_Hs01_00085114 predicted 326
3 SASI_Hs01_00085115 predicted 996
4 SASI_Hs01_00085116 predicted 988
5 SASI_Hs01_00085117 predicted 962
6 SASI_Hs01_00085118 predicted 1049
7 SASI_Hs01_00085119 predicted 315
8 SASI_Hs01_00085120 predicted 1069
9 SASI_Hs01_00085121 predicted 1062
10 SASI_Hs01_00085122 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191286 predicted 1043
2 SASI_Hs01_00191287 predicted 328
3 SASI_Hs01_00191288 predicted 1071
4 SASI_Hs01_00191289 predicted 1057
5 SASI_Hs01_00191290 predicted 1040
6 SASI_Hs01_00191291 predicted 1119
7 SASI_Hs01_00191292 predicted 319
8 SASI_Hs01_00191293 predicted 1146
9 SASI_Hs01_00191294 predicted 1135
10 SASI_Hs01_00191295 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104788 predicted 514
2 SASI_Rn01_00104789 predicted 353
3 SASI_Rn01_00104790 predicted 1095
4 SASI_Rn01_00104791 predicted 599
5 SASI_Rn01_00104792 predicted 1216
6 SASI_Rn01_00104793 predicted 383
7 SASI_Rn01_00104794 predicted 543
8 SASI_Rn01_00104795 predicted 720
9 SASI_Rn01_00104796 predicted 1228
10 SASI_Rn01_00104797 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154257 predicted 214
2 SASI_Mm01_00154258 predicted 366
3 SASI_Mm01_00154259 predicted 906
4 SASI_Mm01_00154260 predicted 219
5 SASI_Mm01_00154262 predicted 615
6 SASI_Mm01_00154261 predicted 841
7 SASI_Mm01_00154263 predicted 1089
8 SASI_Mm01_00154264 predicted 1025
9 SASI_Mm01_00154265 predicted 1242
10 SASI_Mm01_00154266 predicted 1287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006344
CLEC10A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 10, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006344.2-1289s21c1
Sequence:CCGGTTGGAAGCACTGCTAACATTTCTCGAGAAATGTTAGCAGTGCTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006344.2-461s21c1
Sequence:CCGGTCATCATCTGTGTGGTTGGATCTCGAGATCCAACCACACAGATGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006344.2-1475s21c1
Sequence:CCGGACTACCACTCCGATCGCAATACTCGAGTATTGCGATCGGAGTGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-494s1c1
Sequence:CCGGGCTTGGAAGAAACGATAGCATCTCGAGATGCTATCGTTTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-552s1c1
Sequence:CCGGGCAGGCAGTTCATTCTGAAATCTCGAGATTTCAGAATGAACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-821s1c1
Sequence:CCGGAGAAATATCTAGGCTCCGCATCTCGAGATGCGGAGCCTAGATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-234s1c1
Sequence:CCGGGTACTTGGAGAATAAGGTGAACTCGAGTTCACCTTATTCTCCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-625s1c1
Sequence:CCGGGTGGCTACTCTCAACAACAATCTCGAGATTGTTGTTGAGAGTAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-821s1c2
Sequence:CCGGAGAAATATCTAGGCTCCGCATCTCGAGATGCGGAGCCTAGATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000169151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-821s1c3
Sequence:CCGGAGAAATATCTAGGCTCCGCATCTCGAGATGCGGAGCCTAGATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006344
CLEC10A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 10, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006344.2-1289s21c1
Sequence:CCGGTTGGAAGCACTGCTAACATTTCTCGAGAAATGTTAGCAGTGCTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006344.2-461s21c1
Sequence:CCGGTCATCATCTGTGTGGTTGGATCTCGAGATCCAACCACACAGATGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006344.2-1475s21c1
Sequence:CCGGACTACCACTCCGATCGCAATACTCGAGTATTGCGATCGGAGTGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-494s1c1
Sequence:CCGGGCTTGGAAGAAACGATAGCATCTCGAGATGCTATCGTTTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-552s1c1
Sequence:CCGGGCAGGCAGTTCATTCTGAAATCTCGAGATTTCAGAATGAACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-821s1c1
Sequence:CCGGAGAAATATCTAGGCTCCGCATCTCGAGATGCGGAGCCTAGATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-234s1c1
Sequence:CCGGGTACTTGGAGAATAAGGTGAACTCGAGTTCACCTTATTCTCCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-625s1c1
Sequence:CCGGGTGGCTACTCTCAACAACAATCTCGAGATTGTTGTTGAGAGTAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-821s1c2
Sequence:CCGGAGAAATATCTAGGCTCCGCATCTCGAGATGCGGAGCCTAGATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000169151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-821s1c3
Sequence:CCGGAGAAATATCTAGGCTCCGCATCTCGAGATGCGGAGCCTAGATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006344
CLEC10A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 10, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006344.2-1289s21c1
Sequence:CCGGTTGGAAGCACTGCTAACATTTCTCGAGAAATGTTAGCAGTGCTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006344.2-461s21c1
Sequence:CCGGTCATCATCTGTGTGGTTGGATCTCGAGATCCAACCACACAGATGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006344.2-1475s21c1
Sequence:CCGGACTACCACTCCGATCGCAATACTCGAGTATTGCGATCGGAGTGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-494s1c1
Sequence:CCGGGCTTGGAAGAAACGATAGCATCTCGAGATGCTATCGTTTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-552s1c1
Sequence:CCGGGCAGGCAGTTCATTCTGAAATCTCGAGATTTCAGAATGAACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-821s1c1
Sequence:CCGGAGAAATATCTAGGCTCCGCATCTCGAGATGCGGAGCCTAGATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-234s1c1
Sequence:CCGGGTACTTGGAGAATAAGGTGAACTCGAGTTCACCTTATTCTCCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-625s1c1
Sequence:CCGGGTGGCTACTCTCAACAACAATCTCGAGATTGTTGTTGAGAGTAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-821s1c2
Sequence:CCGGAGAAATATCTAGGCTCCGCATCTCGAGATGCGGAGCCTAGATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000169151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006344.1-821s1c3
Sequence:CCGGAGAAATATCTAGGCTCCGCATCTCGAGATGCGGAGCCTAGATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010796
CLEC10A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 10, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-908s1c1
Sequence:CCGGCGACTTTGAGAAAGGCTTTAACTCGAGTTAAAGCCTTTCTCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-850s1c1
Sequence:CCGGTGGTTAGTTGGATCGGCCTAACTCGAGTTAGGCCGATCCAACTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-602s1c1
Sequence:CCGGCCATGTGCAACAGCTGAGGAACTCGAGTTCCTCAGCTGTTGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-1046s1c1
Sequence:CCGGCCGCTGGATCTGTGAGATGAACTCGAGTTCATCTCACAGATCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-397s1c1
Sequence:CCGGCCTCCAAGATAAAGGCTGAATCTCGAGATTCAGCCTTTATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010796
CLEC10A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 10, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-908s1c1
Sequence:CCGGCGACTTTGAGAAAGGCTTTAACTCGAGTTAAAGCCTTTCTCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-850s1c1
Sequence:CCGGTGGTTAGTTGGATCGGCCTAACTCGAGTTAGGCCGATCCAACTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-602s1c1
Sequence:CCGGCCATGTGCAACAGCTGAGGAACTCGAGTTCCTCAGCTGTTGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-1046s1c1
Sequence:CCGGCCGCTGGATCTGTGAGATGAACTCGAGTTCATCTCACAGATCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-397s1c1
Sequence:CCGGCCTCCAAGATAAAGGCTGAATCTCGAGATTCAGCCTTTATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010796
CLEC10A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 10, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-908s1c1
Sequence:CCGGCGACTTTGAGAAAGGCTTTAACTCGAGTTAAAGCCTTTCTCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-850s1c1
Sequence:CCGGTGGTTAGTTGGATCGGCCTAACTCGAGTTAGGCCGATCCAACTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-602s1c1
Sequence:CCGGCCATGTGCAACAGCTGAGGAACTCGAGTTCCTCAGCTGTTGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-1046s1c1
Sequence:CCGGCCGCTGGATCTGTGAGATGAACTCGAGTTCATCTCACAGATCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010796.1-397s1c1
Sequence:CCGGCCTCCAAGATAAAGGCTGAATCTCGAGATTCAGCCTTTATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks