EMAIL THIS PAGE TO A FRIEND

CLEC11A

C-type lectin domain family 11, member A

Synonyms: CLECSF3 LSLCL P47 SCGF
UniProtKB ID: Q9Y240, B2RAD4
Gene ID:
Human(6320) Summary: This gene encodes a member of the C-type lectin superfamily. The encoded protein is a secreted sulfated glycoprotein and functions as a growth factor for primitive hematopoietic progenitor cells. An alternative splice variant has been described but its biological nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(20256) C-type lectin domain family 11, member a
Rat(29313) C-type lectin domain family 11, member A
domestic guinea pig(100717808) C-type lectin domain family 11, member A
naked mole-rat(101720975) C-type lectin domain family 11, member A
sheep(101119074) C-type lectin domain family 11, member A
cow(522611) C-type lectin domain family 11, member A
domestic cat(101087888) C-type lectin domain family 11, member A
dog(611817) C-type lectin domain family 11, member A
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1679 Human SCGF ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002975 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022201 MISSION® esiRNA esiRNA human CLEC11A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002975 Rosetta Predictions human pricing
NM_001012459 Rosetta Predictions rat pricing
NM_009131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126074 predicted 1111
2 SASI_Hs01_00126076 predicted 917
3 SASI_Hs01_00126077 predicted 733
4 SASI_Hs01_00126078 predicted 1010
5 SASI_Hs01_00126079 predicted 861
6 SASI_Hs01_00126080 predicted 1036
7 SASI_Hs01_00126081 predicted 1106
8 SASI_Hs01_00126082 predicted 808
9 SASI_Hs01_00126083 predicted 1109
10 SASI_Hs02_00334847 predicted 1113
11 SASI_Hs01_00126075 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077990 predicted 384
2 SASI_Rn02_00200552 predicted 485
3 SASI_Rn01_00077991 predicted 1297
4 SASI_Rn01_00077992 predicted 1462
5 SASI_Rn01_00077993 predicted 1322
6 SASI_Rn01_00077994 predicted 231
7 SASI_Rn01_00077995 predicted 1507
8 SASI_Rn01_00077996 predicted 1432
9 SASI_Rn01_00077998 predicted 608
10 SASI_Rn02_00200553 predicted 1280
11 SASI_Rn01_00077997 predicted 1400
12 SASI_Rn01_00077999 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164625 predicted 1081
2 SASI_Mm01_00164626 predicted 787
3 SASI_Mm01_00164627 predicted 801
4 SASI_Mm01_00164628 predicted 1146
5 SASI_Mm01_00164629 predicted 1001
6 SASI_Mm01_00164630 predicted 965
7 SASI_Mm01_00164631 predicted 590
8 SASI_Mm01_00164632 predicted 701
9 SASI_Mm01_00164633 predicted 1152
10 SASI_Mm01_00164634 predicted 959
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002975
CLEC11A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 11, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-375s1c1
Sequence:CCGGCTGCCGGAACTGTTGAGGGAACTCGAGTTCCCTCAACAGTTCCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-953s1c1
Sequence:CCGGGTGTCCTTCTTCGCCTGGCATCTCGAGATGCCAGGCGAAGAAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-1120s1c1
Sequence:CCGGTCTCTACTACGTCTGCGAGTTCTCGAGAACTCGCAGACGTAGTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-435s1c1
Sequence:CCGGAGGAGGAGGAAGCAACGCCAACTCGAGTTGGCGTTGCTTCCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-490s1c1
Sequence:CCGGTGAGGACATCGTCACTTACATCTCGAGATGTAAGTGACGATGTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002975.2-1221s21c1
Sequence:CCGGCGGAATCTCCCTTCCCTTCCTCTCGAGAGGAAGGGAAGGGAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002975.2-327s21c1
Sequence:CCGGATCTGCAGGAAGCCCTAGGACCTCGAGGTCCTAGGGCTTCCTGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002975
CLEC11A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 11, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-375s1c1
Sequence:CCGGCTGCCGGAACTGTTGAGGGAACTCGAGTTCCCTCAACAGTTCCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-953s1c1
Sequence:CCGGGTGTCCTTCTTCGCCTGGCATCTCGAGATGCCAGGCGAAGAAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-1120s1c1
Sequence:CCGGTCTCTACTACGTCTGCGAGTTCTCGAGAACTCGCAGACGTAGTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-435s1c1
Sequence:CCGGAGGAGGAGGAAGCAACGCCAACTCGAGTTGGCGTTGCTTCCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-490s1c1
Sequence:CCGGTGAGGACATCGTCACTTACATCTCGAGATGTAAGTGACGATGTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002975.2-1221s21c1
Sequence:CCGGCGGAATCTCCCTTCCCTTCCTCTCGAGAGGAAGGGAAGGGAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002975.2-327s21c1
Sequence:CCGGATCTGCAGGAAGCCCTAGGACCTCGAGGTCCTAGGGCTTCCTGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002975
CLEC11A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 11, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-375s1c1
Sequence:CCGGCTGCCGGAACTGTTGAGGGAACTCGAGTTCCCTCAACAGTTCCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-953s1c1
Sequence:CCGGGTGTCCTTCTTCGCCTGGCATCTCGAGATGCCAGGCGAAGAAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-1120s1c1
Sequence:CCGGTCTCTACTACGTCTGCGAGTTCTCGAGAACTCGCAGACGTAGTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-435s1c1
Sequence:CCGGAGGAGGAGGAAGCAACGCCAACTCGAGTTGGCGTTGCTTCCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002975.2-490s1c1
Sequence:CCGGTGAGGACATCGTCACTTACATCTCGAGATGTAAGTGACGATGTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002975.2-1221s21c1
Sequence:CCGGCGGAATCTCCCTTCCCTTCCTCTCGAGAGGAAGGGAAGGGAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002975.2-327s21c1
Sequence:CCGGATCTGCAGGAAGCCCTAGGACCTCGAGGTCCTAGGGCTTCCTGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009131
CLEC11A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 11, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009131.1-1201s1c1
Sequence:CCGGTCAGAGATTAAGCGTGACCATCTCGAGATGGTCACGCTTAATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-410s1c1
Sequence:CCGGAGCACCTTCTTCTAGTCCCAACTCGAGTTGGGACTAGAAGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-807s1c1
Sequence:CCGGGATGCGCTAAGCCGGTACTTACTCGAGTAAGTACCGGCTTAGCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-1088s1c1
Sequence:CCGGCCTCTACTTCGTCTGCGAGTTCTCGAGAACTCGCAGACGAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-312s1c1
Sequence:CCGGGTGGGAAATGAGGATAATCTTCTCGAGAAGATTATCCTCATTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009131
CLEC11A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 11, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009131.1-1201s1c1
Sequence:CCGGTCAGAGATTAAGCGTGACCATCTCGAGATGGTCACGCTTAATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-410s1c1
Sequence:CCGGAGCACCTTCTTCTAGTCCCAACTCGAGTTGGGACTAGAAGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-807s1c1
Sequence:CCGGGATGCGCTAAGCCGGTACTTACTCGAGTAAGTACCGGCTTAGCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-1088s1c1
Sequence:CCGGCCTCTACTTCGTCTGCGAGTTCTCGAGAACTCGCAGACGAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-312s1c1
Sequence:CCGGGTGGGAAATGAGGATAATCTTCTCGAGAAGATTATCCTCATTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009131
CLEC11A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 11, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009131.1-1201s1c1
Sequence:CCGGTCAGAGATTAAGCGTGACCATCTCGAGATGGTCACGCTTAATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-410s1c1
Sequence:CCGGAGCACCTTCTTCTAGTCCCAACTCGAGTTGGGACTAGAAGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-807s1c1
Sequence:CCGGGATGCGCTAAGCCGGTACTTACTCGAGTAAGTACCGGCTTAGCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-1088s1c1
Sequence:CCGGCCTCTACTTCGTCTGCGAGTTCTCGAGAACTCGCAGACGAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009131.1-312s1c1
Sequence:CCGGGTGGGAAATGAGGATAATCTTCTCGAGAAGATTATCCTCATTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks