EMAIL THIS PAGE TO A FRIEND

CLEC12A

C-type lectin domain family 12, member A

57 Gene Product Result for
Synonyms: CLL-1 CLL1 DCAL-2 MICL
UniProtKB ID: Q5QGZ9, B2RA16, Q6P4H1, Q6RH77, Q6RH78, Q8TDQ6
Gene ID:
Human(160364) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The protein encoded by this gene is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. This gene is closely linked to other CTL/CTLD superfamily members in the natural killer gene complex region on chromosome 12p13. [provided by RefSeq, May 2011]
Mouse(232413) C-type lectin domain family 12, member a
Rat(680338) C-type lectin domain family 12, member A
Horse(100053711) C-type lectin domain family 12, member A
dog(477697) C-type lectin domain family 12, member A
domestic cat(101085474) C-type lectin domain family 12, member A
cow(508740) C-type lectin domain family 12, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138337 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138337 Rosetta Predictions human pricing
NM_201623 Rosetta Predictions human pricing
NM_001134716 Rosetta Predictions rat pricing
NM_177686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012714 predicted 667
2 SASI_Hs01_00012715 predicted 622
3 SASI_Hs02_00363428 predicted 674
4 SASI_Hs01_00012716 predicted 605
5 SASI_Hs01_00012717 predicted 677
6 SASI_Hs01_00012719 predicted 626
7 SASI_Hs01_00012720 predicted 602
8 SASI_Hs01_00012721 predicted 633
9 SASI_Hs01_00012722 predicted 606
10 SASI_Hs01_00012723 predicted 599
11 SASI_Hs01_00012718 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085663 predicted 562
2 SASI_Hs01_00085664 predicted 519
3 SASI_Hs02_00373128 predicted 575
4 SASI_Hs01_00085665 predicted 504
5 SASI_Hs01_00085666 predicted 576
6 SASI_Hs01_00085668 predicted 530
7 SASI_Hs01_00085669 predicted 503
8 SASI_Hs01_00085670 predicted 531
9 SASI_Hs01_00085671 predicted 506
10 SASI_Hs01_00085672 predicted 502
11 SASI_Hs01_00085667 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258154 predicted 743
2 SASI_Rn02_00258155 predicted 675
3 SASI_Rn02_00258156 predicted 324
4 SASI_Rn02_00258157 predicted 560
5 SASI_Rn02_00258158 predicted 903
6 SASI_Rn02_00258159 predicted 1065
7 SASI_Rn02_00258160 predicted 626
8 SASI_Rn02_00258161 predicted 1028
9 SASI_Rn02_00258162 predicted 989
10 SASI_Rn02_00258163 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040793 predicted 728
2 SASI_Mm01_00040794 predicted 561
3 SASI_Mm02_00348015 predicted 816
4 SASI_Mm01_00040795 predicted 794
5 SASI_Mm01_00040796 predicted 259
6 SASI_Mm02_00348016 predicted 767
7 SASI_Mm02_00348017 predicted 848
8 SASI_Mm01_00040797 predicted 719
9 SASI_Mm01_00040798 predicted 728
10 SASI_Mm01_00040799 predicted 562
11 SASI_Mm01_00040792 predicted 798
12 SASI_Mm01_00040800 predicted 806
13 SASI_Mm01_00040801 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138337
CLEC12A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 12, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138337.5-605s21c1
Sequence:CCGGGCATAAGGACAGCTGTTATTTCTCGAGAAATAACAGCTGTCCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138337.5-1420s21c1
Sequence:CCGGTGAAGGCCTTATGAGTCAAAGCTCGAGCTTTGACTCATAAGGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-783s1c1
Sequence:CCGGCGTGGTATGAGAGTGGATAATCTCGAGATTATCCACTCTCATACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-526s1c1
Sequence:CCGGCCAAATTATGTCGTGAGCTATCTCGAGATAGCTCACGACATAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-836s1c1
Sequence:CCGGCGCACCTGACTTAAATAACATCTCGAGATGTTATTTAAGTCAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-550s1c1
Sequence:CCGGGCAAAGAACAAGAGCACAAATCTCGAGATTTGTGCTCTTGTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-306s1c1
Sequence:CCGGGCAGCCTTGTTTCTGACTCTTCTCGAGAAGAGTCAGAAACAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138337
CLEC12A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 12, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138337.5-605s21c1
Sequence:CCGGGCATAAGGACAGCTGTTATTTCTCGAGAAATAACAGCTGTCCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138337.5-1420s21c1
Sequence:CCGGTGAAGGCCTTATGAGTCAAAGCTCGAGCTTTGACTCATAAGGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-783s1c1
Sequence:CCGGCGTGGTATGAGAGTGGATAATCTCGAGATTATCCACTCTCATACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-526s1c1
Sequence:CCGGCCAAATTATGTCGTGAGCTATCTCGAGATAGCTCACGACATAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-836s1c1
Sequence:CCGGCGCACCTGACTTAAATAACATCTCGAGATGTTATTTAAGTCAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-550s1c1
Sequence:CCGGGCAAAGAACAAGAGCACAAATCTCGAGATTTGTGCTCTTGTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-306s1c1
Sequence:CCGGGCAGCCTTGTTTCTGACTCTTCTCGAGAAGAGTCAGAAACAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138337
CLEC12A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 12, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138337.5-605s21c1
Sequence:CCGGGCATAAGGACAGCTGTTATTTCTCGAGAAATAACAGCTGTCCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138337.5-1420s21c1
Sequence:CCGGTGAAGGCCTTATGAGTCAAAGCTCGAGCTTTGACTCATAAGGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-783s1c1
Sequence:CCGGCGTGGTATGAGAGTGGATAATCTCGAGATTATCCACTCTCATACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-526s1c1
Sequence:CCGGCCAAATTATGTCGTGAGCTATCTCGAGATAGCTCACGACATAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-836s1c1
Sequence:CCGGCGCACCTGACTTAAATAACATCTCGAGATGTTATTTAAGTCAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-550s1c1
Sequence:CCGGGCAAAGAACAAGAGCACAAATCTCGAGATTTGTGCTCTTGTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138337.3-306s1c1
Sequence:CCGGGCAGCCTTGTTTCTGACTCTTCTCGAGAAGAGTCAGAAACAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177686
CLEC12A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 12, member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-798s21c1
Sequence:CCGGTAAGAAGTACTGCGGATATATCTCGAGATATATCCGCAGTACTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177686.3-1732s21c1
Sequence:CCGGCTTTATACCCTGTCGTAATAACTCGAGTTATTACGACAGGGTATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.3-654s1c1
Sequence:CCGGCAAGGATGTGCTGGAATTTATCTCGAGATAAATTCCAGCACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177686.3-1732s1c1
Sequence:CCGGCTTTATACCCTGTCGTAATAACTCGAGTTATTACGACAGGGTATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.3-796s1c1
Sequence:CCGGGATAAGAAGTACTGCGGATATCTCGAGATATCCGCAGTACTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-726s21c1
Sequence:CCGGTCGCACACAATATCCACTAAGCTCGAGCTTAGTGGATATTGTGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-654s21c1
Sequence:CCGGCAAGGATGTGCTGGAATTTATCTCGAGATAAATTCCAGCACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-678s21c1
Sequence:CCGGGTACAAGAAGCTACGCTATTTCTCGAGAAATAGCGTAGCTTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.2-529s1c1
Sequence:CCGGCCATGTCCAAAGGGTTCAGAACTCGAGTTCTGAACCCTTTGGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.2-724s1c1
Sequence:CCGGGATCGCACACAATATCCACTACTCGAGTAGTGGATATTGTGTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177686
CLEC12A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 12, member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-798s21c1
Sequence:CCGGTAAGAAGTACTGCGGATATATCTCGAGATATATCCGCAGTACTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177686.3-1732s21c1
Sequence:CCGGCTTTATACCCTGTCGTAATAACTCGAGTTATTACGACAGGGTATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.3-654s1c1
Sequence:CCGGCAAGGATGTGCTGGAATTTATCTCGAGATAAATTCCAGCACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177686.3-1732s1c1
Sequence:CCGGCTTTATACCCTGTCGTAATAACTCGAGTTATTACGACAGGGTATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.3-796s1c1
Sequence:CCGGGATAAGAAGTACTGCGGATATCTCGAGATATCCGCAGTACTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-726s21c1
Sequence:CCGGTCGCACACAATATCCACTAAGCTCGAGCTTAGTGGATATTGTGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-654s21c1
Sequence:CCGGCAAGGATGTGCTGGAATTTATCTCGAGATAAATTCCAGCACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-678s21c1
Sequence:CCGGGTACAAGAAGCTACGCTATTTCTCGAGAAATAGCGTAGCTTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.2-529s1c1
Sequence:CCGGCCATGTCCAAAGGGTTCAGAACTCGAGTTCTGAACCCTTTGGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.2-724s1c1
Sequence:CCGGGATCGCACACAATATCCACTACTCGAGTAGTGGATATTGTGTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177686
CLEC12A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 12, member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-798s21c1
Sequence:CCGGTAAGAAGTACTGCGGATATATCTCGAGATATATCCGCAGTACTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177686.3-1732s21c1
Sequence:CCGGCTTTATACCCTGTCGTAATAACTCGAGTTATTACGACAGGGTATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.3-654s1c1
Sequence:CCGGCAAGGATGTGCTGGAATTTATCTCGAGATAAATTCCAGCACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177686.3-1732s1c1
Sequence:CCGGCTTTATACCCTGTCGTAATAACTCGAGTTATTACGACAGGGTATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.3-796s1c1
Sequence:CCGGGATAAGAAGTACTGCGGATATCTCGAGATATCCGCAGTACTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-726s21c1
Sequence:CCGGTCGCACACAATATCCACTAAGCTCGAGCTTAGTGGATATTGTGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-654s21c1
Sequence:CCGGCAAGGATGTGCTGGAATTTATCTCGAGATAAATTCCAGCACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177686.3-678s21c1
Sequence:CCGGGTACAAGAAGCTACGCTATTTCTCGAGAAATAGCGTAGCTTCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.2-529s1c1
Sequence:CCGGCCATGTCCAAAGGGTTCAGAACTCGAGTTCTGAACCCTTTGGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177686.2-724s1c1
Sequence:CCGGGATCGCACACAATATCCACTACTCGAGTAGTGGATATTGTGTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks