EMAIL THIS PAGE TO A FRIEND

CLEC12B

C-type lectin domain family 12, member B

139 Gene Product Result for
Synonyms: UNQ5782
UniProtKB ID: Q2HXU8, Q6UWF2, Q6ZRG0
Gene ID:
Mouse(71183) C-type lectin domain family 12, member B
Rat(502900) C-type lectin domain family 12, member B
domestic guinea pig(100726391) C-type lectin domain family 12, member B
naked mole-rat(101711144) C-type lectin domain family 12, member B
sheep(101119711) C-type lectin domain family 12, member B
dog(611402) C-type lectin domain family 12, member B
cow(616085) C-type lectin domain family 12, member B
domestic cat(101083012) C-type lectin domain family 12, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301313 ANTI-CLEC12B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084461 MISSION® esiRNA esiRNA human CLEC12B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205852 Rosetta Predictions human pricing
NM_001109353 Rosetta Predictions rat pricing
NM_027709 Rosetta Predictions mouse pricing
XM_132881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216067 predicted 503
2 SASI_Hs01_00216069 predicted 539
3 SASI_Hs02_00373483 predicted 268
4 SASI_Hs02_00373484 predicted 795
5 SASI_Hs02_00373485 predicted 621
6 SASI_Hs01_00216072 predicted 540
7 SASI_Hs01_00216073 predicted 348
8 SASI_Hs01_00216074 predicted 515
9 SASI_Hs01_00216075 predicted 509
10 SASI_Hs01_00216076 predicted 406
11 SASI_Hs01_00216068 predicted 502
12 SASI_Hs01_00216070 predicted 634
13 SASI_Hs01_00216071 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247594 predicted 550
2 SASI_Rn02_00247595 predicted 468
3 SASI_Rn02_00247596 predicted 485
4 SASI_Rn02_00247597 predicted 396
5 SASI_Rn02_00247598 predicted 454
6 SASI_Rn02_00247599 predicted 375
7 SASI_Rn02_00247600 predicted 736
8 SASI_Rn02_00247601 predicted 213
9 SASI_Rn02_00247602 predicted 755
10 SASI_Rn02_00247603 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332611 predicted 778
2 SASI_Mm02_00332612 predicted 493
3 SASI_Mm02_00332613 predicted 510
4 SASI_Mm02_00332614 predicted 467
5 SASI_Mm02_00332615 predicted 376
6 SASI_Mm02_00332616 predicted 856
7 SASI_Mm02_00332617 predicted 849
8 SASI_Mm02_00332618 predicted 823
9 SASI_Mm02_00332619 predicted 452
10 SASI_Mm02_00332620 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220887 predicted 1015
2 SASI_Mm01_00220888 predicted 1007
3 SASI_Mm01_00220889 predicted 1055
4 SASI_Mm01_00220890 predicted 1054
5 SASI_Mm01_00220891 predicted 1159
6 SASI_Mm01_00220892 predicted 1121
7 SASI_Mm01_00220893 predicted 1177
8 SASI_Mm01_00220894 predicted 1130
9 SASI_Mm01_00220895 predicted 1130
10 SASI_Mm01_00220896 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205852
CLEC12B MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 12, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-650s1c1
Sequence:CCGGCAAGAACTCCACCCTAGTGAACTCGAGTTCACTAGGGTGGAGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-181s1c1
Sequence:CCGGCAAGGAATAACCGAGATGGAACTCGAGTTCCATCTCGGTTATTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205852.1-542s1c1
Sequence:CCGGCAGATGTAATCCATGTCCTAACTCGAGTTAGGACATGGATTACATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205852.1-2329s1c1
Sequence:CCGGGCAGAGTAATACACAAACAAACTCGAGTTTGTTTGTGTATTACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205852.1-1083s1c1
Sequence:CCGGCCCTTGAAGAAAGCAGTTATACTCGAGTATAACTGCTTTCTTCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205852.1-193s1c1
Sequence:CCGGGAGATGGAAATAACCTAAGAACTCGAGTTCTTAGGTTATTTCCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205852.1-1606s1c1
Sequence:CCGGCCTCTCATCATAACTACATTTCTCGAGAAATGTAGTTATGATGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-393s1c1
Sequence:CCGGCAGGATAACTTATCCCAGCAACTCGAGTTGCTGGGATAAGTTATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-392s1c1
Sequence:CCGGGCAGGATAACTTATCCCAGCACTCGAGTGCTGGGATAAGTTATCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205852
CLEC12B MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 12, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-650s1c1
Sequence:CCGGCAAGAACTCCACCCTAGTGAACTCGAGTTCACTAGGGTGGAGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-181s1c1
Sequence:CCGGCAAGGAATAACCGAGATGGAACTCGAGTTCCATCTCGGTTATTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205852.1-542s1c1
Sequence:CCGGCAGATGTAATCCATGTCCTAACTCGAGTTAGGACATGGATTACATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205852.1-2329s1c1
Sequence:CCGGGCAGAGTAATACACAAACAAACTCGAGTTTGTTTGTGTATTACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205852.1-1083s1c1
Sequence:CCGGCCCTTGAAGAAAGCAGTTATACTCGAGTATAACTGCTTTCTTCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205852.1-193s1c1
Sequence:CCGGGAGATGGAAATAACCTAAGAACTCGAGTTCTTAGGTTATTTCCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205852.1-1606s1c1
Sequence:CCGGCCTCTCATCATAACTACATTTCTCGAGAAATGTAGTTATGATGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-393s1c1
Sequence:CCGGCAGGATAACTTATCCCAGCAACTCGAGTTGCTGGGATAAGTTATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-392s1c1
Sequence:CCGGGCAGGATAACTTATCCCAGCACTCGAGTGCTGGGATAAGTTATCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205852
CLEC12B MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 12, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-650s1c1
Sequence:CCGGCAAGAACTCCACCCTAGTGAACTCGAGTTCACTAGGGTGGAGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-181s1c1
Sequence:CCGGCAAGGAATAACCGAGATGGAACTCGAGTTCCATCTCGGTTATTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205852.1-542s1c1
Sequence:CCGGCAGATGTAATCCATGTCCTAACTCGAGTTAGGACATGGATTACATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205852.1-2329s1c1
Sequence:CCGGGCAGAGTAATACACAAACAAACTCGAGTTTGTTTGTGTATTACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205852.1-1083s1c1
Sequence:CCGGCCCTTGAAGAAAGCAGTTATACTCGAGTATAACTGCTTTCTTCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205852.1-193s1c1
Sequence:CCGGGAGATGGAAATAACCTAAGAACTCGAGTTCTTAGGTTATTTCCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205852.1-1606s1c1
Sequence:CCGGCCTCTCATCATAACTACATTTCTCGAGAAATGTAGTTATGATGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-393s1c1
Sequence:CCGGCAGGATAACTTATCCCAGCAACTCGAGTTGCTGGGATAAGTTATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205852.1-392s1c1
Sequence:CCGGGCAGGATAACTTATCCCAGCACTCGAGTGCTGGGATAAGTTATCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027709
CLEC12B MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 12, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-698s21c1
Sequence:CCGGGACAAGGAGCTTGCGAGTTTCCTCGAGGAAACTCGCAAGCTCCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-656s21c1
Sequence:CCGGCTGTGGGAGGATGGTTCATTCCTCGAGGAATGAACCATCCTCCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027709.1-1122s21c1
Sequence:CCGGCATGGATACTGGGTGATATTTCTCGAGAAATATCACCCAGTATCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-460s21c1
Sequence:CCGGTGGAAACAGTTGCTACTATTTCTCGAGAAATAGTAGCAACTGTTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-408s21c1
Sequence:CCGGTCCACGCTTCTGACCATAAATCTCGAGATTTATGGTCAGAAGCGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027709
CLEC12B MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 12, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-698s21c1
Sequence:CCGGGACAAGGAGCTTGCGAGTTTCCTCGAGGAAACTCGCAAGCTCCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-656s21c1
Sequence:CCGGCTGTGGGAGGATGGTTCATTCCTCGAGGAATGAACCATCCTCCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027709.1-1122s21c1
Sequence:CCGGCATGGATACTGGGTGATATTTCTCGAGAAATATCACCCAGTATCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-460s21c1
Sequence:CCGGTGGAAACAGTTGCTACTATTTCTCGAGAAATAGTAGCAACTGTTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-408s21c1
Sequence:CCGGTCCACGCTTCTGACCATAAATCTCGAGATTTATGGTCAGAAGCGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027709
CLEC12B MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 12, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-698s21c1
Sequence:CCGGGACAAGGAGCTTGCGAGTTTCCTCGAGGAAACTCGCAAGCTCCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-656s21c1
Sequence:CCGGCTGTGGGAGGATGGTTCATTCCTCGAGGAATGAACCATCCTCCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027709.1-1122s21c1
Sequence:CCGGCATGGATACTGGGTGATATTTCTCGAGAAATATCACCCAGTATCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-460s21c1
Sequence:CCGGTGGAAACAGTTGCTACTATTTCTCGAGAAATAGTAGCAACTGTTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027709.1-408s21c1
Sequence:CCGGTCCACGCTTCTGACCATAAATCTCGAGATTTATGGTCAGAAGCGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)