EMAIL THIS PAGE TO A FRIEND

CLEC14A

C-type lectin domain family 14, member A

84 Gene Product Result for
Synonyms: C14orf27 CEG1 EGFR-5
UniProtKB ID: Q86T13, Q695G9, Q6PWT6, Q8N5V5
Gene ID:
Human(161198) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This family member plays a role in cell-cell adhesion and angiogenesis. It functions in filopodia formation, cell migration and tube formation. Due to its presence at higher levels in tumor endothelium than in normal tissue endothelium, it is considered to be a candidate for tumor vascular targeting. [provided by RefSeq, Jan 2012]
Mouse(66864) C-type lectin domain family 14, member a
Rat(314148) C-type lectin domain family 14, member A
Zebrafish(327325) C-type lectin domain family 14, member A
domestic cat(101086152) C-type lectin domain family 14, member A
dog(490660) C-type lectin domain family 14, member A
cow(509367) C-type lectin domain family 14, member A
sheep(101106287) C-type lectin domain family 14, member A
naked mole-rat(101712459) C-type lectin domain family 14, member A
domestic guinea pig(100731572) C-type lectin domain family 14, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175060 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175060 Rosetta Predictions human pricing
NM_001014077 Rosetta Predictions rat pricing
NM_025809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062665 predicted 1884
2 SASI_Hs01_00062666 predicted 1996
3 SASI_Hs01_00062667 predicted 1879
4 SASI_Hs01_00062668 predicted 1398
5 SASI_Hs01_00062669 predicted 1942
6 SASI_Hs01_00062670 predicted 1342
7 SASI_Hs01_00062671 predicted 1561
8 SASI_Hs01_00062672 predicted 1740
9 SASI_Hs01_00062673 predicted 1419
10 SASI_Hs01_00062674 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119815 predicted 1246
2 SASI_Rn01_00119816 predicted 844
3 SASI_Rn02_00201493 predicted 1106
4 SASI_Rn01_00119817 predicted 942
5 SASI_Rn02_00201494 predicted 1105
6 SASI_Rn01_00119818 predicted 1170
7 SASI_Rn01_00119819 predicted 940
8 SASI_Rn01_00119820 predicted 1168
9 SASI_Rn01_00119822 predicted 894
10 SASI_Rn01_00119823 predicted 1064
11 SASI_Rn01_00119821 predicted 1260
12 SASI_Rn01_00119824 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112244 predicted 1221
2 SASI_Mm01_00112245 predicted 1217
3 SASI_Mm01_00112246 predicted 838
4 SASI_Mm01_00112247 predicted 1502
5 SASI_Mm01_00112248 predicted 1083
6 SASI_Mm01_00112250 predicted 612
7 SASI_Mm01_00112251 predicted 948
8 SASI_Mm01_00112252 predicted 450
9 SASI_Mm01_00112253 predicted 1476
10 SASI_Mm02_00329052 predicted 1364
11 SASI_Mm01_00112249 predicted 1185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025809
CLEC14A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 14, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025809.5-2277s21c1
Sequence:CCGGACTTATACAAAGGGTGTTATTCTCGAGAATAACACCCTTTGTATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025809.5-1594s21c1
Sequence:CCGGACTTGTGAGCATAGCAGTTATCTCGAGATAACTGCTATGCTCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025809.5-1855s21c1
Sequence:CCGGACTTAGGGAAACACCTCAATGCTCGAGCATTGAGGTGTTTCCCTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-904s1c1
Sequence:CCGGCGGACGTTCTTGTGAGACCAACTCGAGTTGGTCTCACAAGAACGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025809.3-3940s1c1
Sequence:CCGGCCCTGTTATCTTACACACTAACTCGAGTTAGTGTGTAAGATAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-614s1c1
Sequence:CCGGGCCTCTAATTTGAGTTTCCAACTCGAGTTGGAAACTCAAATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-553s1c1
Sequence:CCGGCGATGGCTACCTATGCAAGTACTCGAGTACTTGCATAGGTAGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-1082s1c1
Sequence:CCGGCAGAGTACTTTACCTACTATTCTCGAGAATAGTAGGTAAAGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025809
CLEC14A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 14, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025809.5-2277s21c1
Sequence:CCGGACTTATACAAAGGGTGTTATTCTCGAGAATAACACCCTTTGTATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025809.5-1594s21c1
Sequence:CCGGACTTGTGAGCATAGCAGTTATCTCGAGATAACTGCTATGCTCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025809.5-1855s21c1
Sequence:CCGGACTTAGGGAAACACCTCAATGCTCGAGCATTGAGGTGTTTCCCTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-904s1c1
Sequence:CCGGCGGACGTTCTTGTGAGACCAACTCGAGTTGGTCTCACAAGAACGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025809.3-3940s1c1
Sequence:CCGGCCCTGTTATCTTACACACTAACTCGAGTTAGTGTGTAAGATAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-614s1c1
Sequence:CCGGGCCTCTAATTTGAGTTTCCAACTCGAGTTGGAAACTCAAATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-553s1c1
Sequence:CCGGCGATGGCTACCTATGCAAGTACTCGAGTACTTGCATAGGTAGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-1082s1c1
Sequence:CCGGCAGAGTACTTTACCTACTATTCTCGAGAATAGTAGGTAAAGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025809
CLEC14A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 14, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025809.5-2277s21c1
Sequence:CCGGACTTATACAAAGGGTGTTATTCTCGAGAATAACACCCTTTGTATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025809.5-1594s21c1
Sequence:CCGGACTTGTGAGCATAGCAGTTATCTCGAGATAACTGCTATGCTCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025809.5-1855s21c1
Sequence:CCGGACTTAGGGAAACACCTCAATGCTCGAGCATTGAGGTGTTTCCCTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-904s1c1
Sequence:CCGGCGGACGTTCTTGTGAGACCAACTCGAGTTGGTCTCACAAGAACGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025809.3-3940s1c1
Sequence:CCGGCCCTGTTATCTTACACACTAACTCGAGTTAGTGTGTAAGATAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-614s1c1
Sequence:CCGGGCCTCTAATTTGAGTTTCCAACTCGAGTTGGAAACTCAAATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-553s1c1
Sequence:CCGGCGATGGCTACCTATGCAAGTACTCGAGTACTTGCATAGGTAGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025809.3-1082s1c1
Sequence:CCGGCAGAGTACTTTACCTACTATTCTCGAGAATAGTAGGTAAAGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175060
CLEC14A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 14, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175060.1-1708s1c1
Sequence:CCGGCCAGTTCTGCACATTGCACAACTCGAGTTGTGCAATGTGCAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175060.1-1608s1c1
Sequence:CCGGGTCAAGCTCTGCTTTCACGAACTCGAGTTCGTGAAAGCAGAGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175060.1-854s1c1
Sequence:CCGGCCTGTGCAAGTACCAGTTTGACTCGAGTCAAACTGGTACTTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175060.1-1007s1c1
Sequence:CCGGCCCGATCTCAGTTACTTGCATCTCGAGATGCAAGTAACTGAGATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175060.1-2074s1c1
Sequence:CCGGCGGAGAATTTGGAGAAGTGATCTCGAGATCACTTCTCCAAATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175060.1-1925s1c1
Sequence:CCGGCCCTTCCTCTAAATTCCCTTTCTCGAGAAAGGGAATTTAGAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175060.1-860s1c1
Sequence:CCGGCAAGTACCAGTTTGAGGTCTTCTCGAGAAGACCTCAAACTGGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175060
CLEC14A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 14, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175060.1-1708s1c1
Sequence:CCGGCCAGTTCTGCACATTGCACAACTCGAGTTGTGCAATGTGCAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175060.1-1608s1c1
Sequence:CCGGGTCAAGCTCTGCTTTCACGAACTCGAGTTCGTGAAAGCAGAGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175060.1-854s1c1
Sequence:CCGGCCTGTGCAAGTACCAGTTTGACTCGAGTCAAACTGGTACTTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175060.1-1007s1c1
Sequence:CCGGCCCGATCTCAGTTACTTGCATCTCGAGATGCAAGTAACTGAGATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175060.1-2074s1c1
Sequence:CCGGCGGAGAATTTGGAGAAGTGATCTCGAGATCACTTCTCCAAATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175060.1-1925s1c1
Sequence:CCGGCCCTTCCTCTAAATTCCCTTTCTCGAGAAAGGGAATTTAGAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175060.1-860s1c1
Sequence:CCGGCAAGTACCAGTTTGAGGTCTTCTCGAGAAGACCTCAAACTGGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175060
CLEC14A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 14, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175060.1-1708s1c1
Sequence:CCGGCCAGTTCTGCACATTGCACAACTCGAGTTGTGCAATGTGCAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175060.1-1608s1c1
Sequence:CCGGGTCAAGCTCTGCTTTCACGAACTCGAGTTCGTGAAAGCAGAGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175060.1-854s1c1
Sequence:CCGGCCTGTGCAAGTACCAGTTTGACTCGAGTCAAACTGGTACTTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175060.1-1007s1c1
Sequence:CCGGCCCGATCTCAGTTACTTGCATCTCGAGATGCAAGTAACTGAGATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175060.1-2074s1c1
Sequence:CCGGCGGAGAATTTGGAGAAGTGATCTCGAGATCACTTCTCCAAATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175060.1-1925s1c1
Sequence:CCGGCCCTTCCTCTAAATTCCCTTTCTCGAGAAAGGGAATTTAGAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175060.1-860s1c1
Sequence:CCGGCAAGTACCAGTTTGAGGTCTTCTCGAGAAGACCTCAAACTGGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks