EMAIL THIS PAGE TO A FRIEND

CLEC16A

C-type lectin domain family 16, member A

119 Gene Product Result for
Synonyms: Gop-1 KIAA0350
UniProtKB ID: Q2KHT3, O15058, Q6ZTB2
Gene ID:
Human(23274) Summary: This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(74374) C-type lectin domain family 16, member A
Rat(287044) C-type lectin domain family 16, member A
domestic guinea pig(100726603) C-type lectin domain family 16, member A
naked mole-rat(101722045) C-type lectin domain family 16, member A
sheep(101107063) C-type lectin domain family 16, member A
Zebrafish(393184) C-type lectin domain family 16, member A
cow(615054) C-type lectin domain family 16, member A
Horse(100056501) C-type lectin domain family 16, member A
domestic cat(101084592) C-type lectin domain family 16, member A
dog(100685190) C-type lectin domain family 16, member A
chicken(416632) C-type lectin domain family 16, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015226 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041561 MISSION® esiRNA esiRNA human CLEC16A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015226 Rosetta Predictions human pricing
XM_213209 Rosetta Predictions rat pricing
XR_009226 Rosetta Predictions rat pricing
NM_177562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062645 predicted 707
2 SASI_Hs01_00062646 predicted 627
3 SASI_Hs01_00062647 predicted 690
4 SASI_Hs01_00062648 predicted 1176
5 SASI_Hs01_00062650 predicted 639
6 SASI_Hs02_00347336 predicted 701
7 SASI_Hs01_00062651 predicted 2260
8 SASI_Hs01_00062652 predicted 1171
9 SASI_Hs01_00062653 predicted 501
10 SASI_Hs01_00062654 predicted 1170
11 SASI_Hs01_00062649 predicted 1649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374409 predicted 560
2 SASI_Rn02_00374410 predicted 552
3 SASI_Rn02_00374411 predicted 2983
4 SASI_Rn02_00374412 predicted 690
5 SASI_Rn02_00374413 predicted 736
6 SASI_Rn02_00374414 predicted 743
7 SASI_Rn02_00374415 predicted 529
8 SASI_Rn02_00374416 predicted 609
9 SASI_Rn02_00374417 predicted 450
10 SASI_Rn02_00374418 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135130 predicted 564
2 SASI_Rn01_00135131 predicted 552
3 SASI_Rn02_00419155 predicted 4593
4 SASI_Rn01_00135132 predicted 5801
5 SASI_Rn01_00135133 predicted 4890
6 SASI_Rn01_00135135 predicted 535
7 SASI_Rn01_00135136 predicted 4514
8 SASI_Rn02_00419156 predicted 5368
9 SASI_Rn01_00135138 predicted 447
10 SASI_Rn01_00135139 predicted 5833
11 SASI_Rn01_00135134 predicted 739
12 SASI_Rn01_00135137 predicted 4910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164461 predicted 664
2 SASI_Mm02_00347719 predicted 2374
3 SASI_Mm01_00164462 predicted 1985
4 SASI_Mm01_00164463 predicted 864
5 SASI_Mm01_00164464 predicted 516
6 SASI_Mm01_00164466 predicted 538
7 SASI_Mm01_00164467 predicted 507
8 SASI_Mm01_00164468 predicted 730
9 SASI_Mm01_00164469 predicted 1194
10 SASI_Mm01_00164470 predicted 1922
11 SASI_Mm01_00164465 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015226
CLEC16A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 16, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015226.1-4430s1c1
Sequence:CCGGGCTGCTGATCTGAATATGGAACTCGAGTTCCATATTCAGATCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015226.1-1172s1c1
Sequence:CCGGGCTAAGACTGAACAGGATATTCTCGAGAATATCCTGTTCAGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015226.1-6568s1c1
Sequence:CCGGCCTTATGTTTCCTTGAGCTAACTCGAGTTAGCTCAAGGAAACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015226.1-2440s1c1
Sequence:CCGGCCTGAACATCACCATCCACAACTCGAGTTGTGGATGGTGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015226.1-328s1c1
Sequence:CCGGCAGCTCTGTATTTGACTTCTTCTCGAGAAGAAGTCAAATACAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015226.2-556s21c1
Sequence:CCGGGTCACGAGACCTCACTTTATTCTCGAGAATAAAGTGAGGTCTCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015226.2-1744s21c1
Sequence:CCGGTCTATGCCATGTCTCATAATACTCGAGTATTATGAGACATGGCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015226.2-2018s21c1
Sequence:CCGGTGTTCACCTTGTACGACATTTCTCGAGAAATGTCGTACAAGGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015226
CLEC16A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 16, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015226.1-4430s1c1
Sequence:CCGGGCTGCTGATCTGAATATGGAACTCGAGTTCCATATTCAGATCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015226.1-1172s1c1
Sequence:CCGGGCTAAGACTGAACAGGATATTCTCGAGAATATCCTGTTCAGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015226.1-6568s1c1
Sequence:CCGGCCTTATGTTTCCTTGAGCTAACTCGAGTTAGCTCAAGGAAACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015226.1-2440s1c1
Sequence:CCGGCCTGAACATCACCATCCACAACTCGAGTTGTGGATGGTGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015226.1-328s1c1
Sequence:CCGGCAGCTCTGTATTTGACTTCTTCTCGAGAAGAAGTCAAATACAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015226.2-556s21c1
Sequence:CCGGGTCACGAGACCTCACTTTATTCTCGAGAATAAAGTGAGGTCTCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015226.2-1744s21c1
Sequence:CCGGTCTATGCCATGTCTCATAATACTCGAGTATTATGAGACATGGCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015226.2-2018s21c1
Sequence:CCGGTGTTCACCTTGTACGACATTTCTCGAGAAATGTCGTACAAGGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015226
CLEC16A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 16, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015226.1-4430s1c1
Sequence:CCGGGCTGCTGATCTGAATATGGAACTCGAGTTCCATATTCAGATCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015226.1-1172s1c1
Sequence:CCGGGCTAAGACTGAACAGGATATTCTCGAGAATATCCTGTTCAGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015226.1-6568s1c1
Sequence:CCGGCCTTATGTTTCCTTGAGCTAACTCGAGTTAGCTCAAGGAAACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015226.1-2440s1c1
Sequence:CCGGCCTGAACATCACCATCCACAACTCGAGTTGTGGATGGTGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015226.1-328s1c1
Sequence:CCGGCAGCTCTGTATTTGACTTCTTCTCGAGAAGAAGTCAAATACAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015226.2-556s21c1
Sequence:CCGGGTCACGAGACCTCACTTTATTCTCGAGAATAAAGTGAGGTCTCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015226.2-1744s21c1
Sequence:CCGGTCTATGCCATGTCTCATAATACTCGAGTATTATGAGACATGGCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015226.2-2018s21c1
Sequence:CCGGTGTTCACCTTGTACGACATTTCTCGAGAAATGTCGTACAAGGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177562
VALIDATED
CLEC16A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 16, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177562.3-581s1c1
Sequence:CCGGCGAGGAGATCATGGCGTATTACTCGAGTAATACGCCATGATCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177562.3-503s1c1
Sequence:CCGGCCACGAGACATCGCTCTATTACTCGAGTAATAGAGCGATGTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177562.3-2515s1c1
Sequence:CCGGCGGATCATATCCGCTGCATTACTCGAGTAATGCAGCGGATATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177562.3-2785s1c1
Sequence:CCGGCCCAGTGCATAAACCAGCATACTCGAGTATGCTGGTTTATGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-3658s21c1
Sequence:CCGGTGGAGAAGCAAACCTAGATAACTCGAGTTATCTAGGTTTGCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-2504s21c1
Sequence:CCGGCTTCGTGTTCTCGGATCATATCTCGAGATATGATCCGAGAACACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-581s21c1
Sequence:CCGGCGAGGAGATCATGGCGTATTACTCGAGTAATACGCCATGATCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-503s21c1
Sequence:CCGGCCACGAGACATCGCTCTATTACTCGAGTAATAGAGCGATGTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177562.4-721s21c1
Sequence:CCGGCCGAAAGCATGGTTCGAATTGCTCGAGCAATTCGAACCATGCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177562
VALIDATED
CLEC16A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 16, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177562.3-581s1c1
Sequence:CCGGCGAGGAGATCATGGCGTATTACTCGAGTAATACGCCATGATCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177562.3-503s1c1
Sequence:CCGGCCACGAGACATCGCTCTATTACTCGAGTAATAGAGCGATGTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177562.3-2515s1c1
Sequence:CCGGCGGATCATATCCGCTGCATTACTCGAGTAATGCAGCGGATATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177562.3-2785s1c1
Sequence:CCGGCCCAGTGCATAAACCAGCATACTCGAGTATGCTGGTTTATGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-3658s21c1
Sequence:CCGGTGGAGAAGCAAACCTAGATAACTCGAGTTATCTAGGTTTGCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-2504s21c1
Sequence:CCGGCTTCGTGTTCTCGGATCATATCTCGAGATATGATCCGAGAACACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-581s21c1
Sequence:CCGGCGAGGAGATCATGGCGTATTACTCGAGTAATACGCCATGATCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-503s21c1
Sequence:CCGGCCACGAGACATCGCTCTATTACTCGAGTAATAGAGCGATGTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177562.4-721s21c1
Sequence:CCGGCCGAAAGCATGGTTCGAATTGCTCGAGCAATTCGAACCATGCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177562
VALIDATED
CLEC16A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 16, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177562.3-581s1c1
Sequence:CCGGCGAGGAGATCATGGCGTATTACTCGAGTAATACGCCATGATCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177562.3-503s1c1
Sequence:CCGGCCACGAGACATCGCTCTATTACTCGAGTAATAGAGCGATGTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177562.3-2515s1c1
Sequence:CCGGCGGATCATATCCGCTGCATTACTCGAGTAATGCAGCGGATATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177562.3-2785s1c1
Sequence:CCGGCCCAGTGCATAAACCAGCATACTCGAGTATGCTGGTTTATGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-3658s21c1
Sequence:CCGGTGGAGAAGCAAACCTAGATAACTCGAGTTATCTAGGTTTGCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-2504s21c1
Sequence:CCGGCTTCGTGTTCTCGGATCATATCTCGAGATATGATCCGAGAACACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-581s21c1
Sequence:CCGGCGAGGAGATCATGGCGTATTACTCGAGTAATACGCCATGATCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177562.4-503s21c1
Sequence:CCGGCCACGAGACATCGCTCTATTACTCGAGTAATAGAGCGATGTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177562.4-721s21c1
Sequence:CCGGCCGAAAGCATGGTTCGAATTGCTCGAGCAATTCGAACCATGCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks