EMAIL THIS PAGE TO A FRIEND

CLEC17A

C-type lectin domain family 17, member A

52 Gene Product Result for
UniProtKB ID: Q6ZS10, A8MX68, B2RTX0, B7ZMM4
Gene ID:
cow(100299814) C-type lectin domain family 17, member A
dog(610758) C-type lectin domain family 17, member A
domestic cat(101098039) C-type lectin domain family 17, member A
sheep(101117076) C-type lectin domain family 17, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371143 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207390 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207943 predicted 714
2 SASI_Hs02_00373992 predicted 861
3 SASI_Hs01_00207944 predicted 627
4 SASI_Hs01_00207946 predicted 618
5 SASI_Hs01_00207947 predicted 1014
6 SASI_Hs01_00207948 predicted 796
7 SASI_Hs01_00207949 predicted 596
8 SASI_Hs01_00207950 predicted 1087
9 SASI_Hs01_00207951 predicted 703
10 SASI_Hs02_00373993 predicted 769
11 SASI_Hs01_00207945 predicted 351
12 SASI_Hs01_00207952 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371143
CLEC17A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 17, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371143.2-1682s1c1
Sequence:CCGGGCTTCCCAAATTGTGAGGATTCTCGAGAATCCTCACAATTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-713s1c1
Sequence:CCGGGCGAACAAATATGACTGGCATCTCGAGATGCCAGTCATATTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-233s1c1
Sequence:CCGGTGAGAACTCAACACCTCCCTACTCGAGTAGGGAGGTGTTGAGTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-650s1c1
Sequence:CCGGCCTGATTAAGTACCAGGAGTTCTCGAGAACTCCTGGTACTTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-653s1c1
Sequence:CCGGGATTAAGTACCAGGAGTTGATCTCGAGATCAACTCCTGGTACTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371143
CLEC17A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 17, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371143.2-1682s1c1
Sequence:CCGGGCTTCCCAAATTGTGAGGATTCTCGAGAATCCTCACAATTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-713s1c1
Sequence:CCGGGCGAACAAATATGACTGGCATCTCGAGATGCCAGTCATATTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-233s1c1
Sequence:CCGGTGAGAACTCAACACCTCCCTACTCGAGTAGGGAGGTGTTGAGTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-650s1c1
Sequence:CCGGCCTGATTAAGTACCAGGAGTTCTCGAGAACTCCTGGTACTTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-653s1c1
Sequence:CCGGGATTAAGTACCAGGAGTTGATCTCGAGATCAACTCCTGGTACTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371143
CLEC17A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 17, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371143.2-1682s1c1
Sequence:CCGGGCTTCCCAAATTGTGAGGATTCTCGAGAATCCTCACAATTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-713s1c1
Sequence:CCGGGCGAACAAATATGACTGGCATCTCGAGATGCCAGTCATATTTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-233s1c1
Sequence:CCGGTGAGAACTCAACACCTCCCTACTCGAGTAGGGAGGTGTTGAGTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-650s1c1
Sequence:CCGGCCTGATTAAGTACCAGGAGTTCTCGAGAACTCCTGGTACTTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371143.2-653s1c1
Sequence:CCGGGATTAAGTACCAGGAGTTGATCTCGAGATCAACTCCTGGTACTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks