EMAIL THIS PAGE TO A FRIEND

CLEC18A

C-type lectin domain family 18, member A

Synonyms: MRCL MRCL1 MRLP2
UniProtKB ID: A5D8T8, A8K1G9, Q6DCB3, Q7Z5K9, Q96HH2
Gene ID:
Human(348174) Summary: This is one of three closely related paralogous genes on chromosome 16 encoding secreted proteins containing C-type lectin domains. These domains bind to carbohydrates in the presence of calcium, and may be involved in cell adhesion, immune response and apoptosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2012]
Mouse(353287) C-type lectin domain family 18, member A
domestic guinea pig(100717379) C-type lectin domain family 18, member A
chicken(431137) C-type lectin domain family 18, member A
dog(610461) C-type lectin domain family 18, member A
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301323 ANTI-CLEC18A (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181549 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181549 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181549 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182619 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182619 Rosetta Predictions human pricing
NM_181549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166587 predicted 1008
2 SASI_Hs02_00370758 predicted 605
3 SASI_Hs01_00166588 predicted 1711
4 SASI_Hs01_00166589 predicted 1532
5 SASI_Hs01_00166590 predicted 783
6 SASI_Hs01_00166592 predicted 710
7 SASI_Hs01_00166593 predicted 883
8 SASI_Hs01_00166594 predicted 1283
9 SASI_Hs01_00166595 predicted 695
10 SASI_Hs01_00166596 predicted 1684
11 SASI_Hs01_00166591 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191494 predicted 1297
2 SASI_Mm01_00191495 predicted 537
3 SASI_Mm01_00191496 predicted 1335
4 SASI_Mm01_00191497 predicted 916
5 SASI_Mm01_00191498 predicted 211
6 SASI_Mm01_00191499 predicted 412
7 SASI_Mm02_00349830 predicted 790
8 SASI_Mm01_00191500 predicted 1034
9 SASI_Mm01_00191501 predicted 905
10 SASI_Mm01_00191502 predicted 1204
11 SASI_Mm01_00191493 predicted 1578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181549
CLEC18A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 18, member A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181549.2-2004s1c1
Sequence:CCGGCCTAAGTTGTTGAGGAGAAATCTCGAGATTTCTCCTCAACAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181549.2-1409s1c1
Sequence:CCGGGCTCACCTACAAGGCAGCTAACTCGAGTTAGCTGCCTTGTAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181549.2-1115s1c1
Sequence:CCGGGAAAGAAGAATGTTCCTGTATCTCGAGATACAGGAACATTCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181549.2-1261s1c1
Sequence:CCGGCCAAGATGAAATGTCAGGGAACTCGAGTTCCCTGACATTTCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181549
CLEC18A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 18, member A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181549.2-2004s1c1
Sequence:CCGGCCTAAGTTGTTGAGGAGAAATCTCGAGATTTCTCCTCAACAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181549.2-1409s1c1
Sequence:CCGGGCTCACCTACAAGGCAGCTAACTCGAGTTAGCTGCCTTGTAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181549.2-1115s1c1
Sequence:CCGGGAAAGAAGAATGTTCCTGTATCTCGAGATACAGGAACATTCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181549.2-1261s1c1
Sequence:CCGGCCAAGATGAAATGTCAGGGAACTCGAGTTCCCTGACATTTCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181549
CLEC18A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 18, member A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181549.2-2004s1c1
Sequence:CCGGCCTAAGTTGTTGAGGAGAAATCTCGAGATTTCTCCTCAACAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181549.2-1409s1c1
Sequence:CCGGGCTCACCTACAAGGCAGCTAACTCGAGTTAGCTGCCTTGTAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181549.2-1115s1c1
Sequence:CCGGGAAAGAAGAATGTTCCTGTATCTCGAGATACAGGAACATTCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181549.2-1261s1c1
Sequence:CCGGCCAAGATGAAATGTCAGGGAACTCGAGTTCCCTGACATTTCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182619
CLEC18A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 18, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1225s1c1
Sequence:CCGGCCAGGATGAAATGTCAGAGGACTCGAGTCCTCTGACATTTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-386s1c1
Sequence:CCGGGAACAGGAAGGAGAGTTTCTTCTCGAGAAGAAACTCTCCTTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1214s1c1
Sequence:CCGGCTATTACAGAGCCAGGATGAACTCGAGTTCATCCTGGCTCTGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1328s1c1
Sequence:CCGGCGAGGTGATTGACAGTGACTTCTCGAGAAGTCACTGTCAATCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182619.1-1721s1c1
Sequence:CCGGCCTTGCACAATGCCAGAAGTTCTCGAGAACTTCTGGCATTGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-392s1c1
Sequence:CCGGGAAGGAGAGTTTCTTGCTCCTCTCGAGAGGAGCAAGAAACTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1537s1c1
Sequence:CCGGGAAACCGTTACATCTGCCAGTCTCGAGACTGGCAGATGTAACGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-621s1c1
Sequence:CCGGGAAGTGGTCAGCCTATGGTTTCTCGAGAAACCATAGGCTGACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163136    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182619.1-1819s1c1
Sequence:CCGGGATTGGGAAGATGGGCTTCAACTCGAGTTGAAGCCCATCTTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182619
CLEC18A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 18, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1225s1c1
Sequence:CCGGCCAGGATGAAATGTCAGAGGACTCGAGTCCTCTGACATTTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-386s1c1
Sequence:CCGGGAACAGGAAGGAGAGTTTCTTCTCGAGAAGAAACTCTCCTTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1214s1c1
Sequence:CCGGCTATTACAGAGCCAGGATGAACTCGAGTTCATCCTGGCTCTGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1328s1c1
Sequence:CCGGCGAGGTGATTGACAGTGACTTCTCGAGAAGTCACTGTCAATCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182619.1-1721s1c1
Sequence:CCGGCCTTGCACAATGCCAGAAGTTCTCGAGAACTTCTGGCATTGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-392s1c1
Sequence:CCGGGAAGGAGAGTTTCTTGCTCCTCTCGAGAGGAGCAAGAAACTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1537s1c1
Sequence:CCGGGAAACCGTTACATCTGCCAGTCTCGAGACTGGCAGATGTAACGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-621s1c1
Sequence:CCGGGAAGTGGTCAGCCTATGGTTTCTCGAGAAACCATAGGCTGACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163136    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182619.1-1819s1c1
Sequence:CCGGGATTGGGAAGATGGGCTTCAACTCGAGTTGAAGCCCATCTTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182619
CLEC18A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 18, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1225s1c1
Sequence:CCGGCCAGGATGAAATGTCAGAGGACTCGAGTCCTCTGACATTTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-386s1c1
Sequence:CCGGGAACAGGAAGGAGAGTTTCTTCTCGAGAAGAAACTCTCCTTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1214s1c1
Sequence:CCGGCTATTACAGAGCCAGGATGAACTCGAGTTCATCCTGGCTCTGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1328s1c1
Sequence:CCGGCGAGGTGATTGACAGTGACTTCTCGAGAAGTCACTGTCAATCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182619.1-1721s1c1
Sequence:CCGGCCTTGCACAATGCCAGAAGTTCTCGAGAACTTCTGGCATTGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-392s1c1
Sequence:CCGGGAAGGAGAGTTTCTTGCTCCTCTCGAGAGGAGCAAGAAACTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-1537s1c1
Sequence:CCGGGAAACCGTTACATCTGCCAGTCTCGAGACTGGCAGATGTAACGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182619.1-621s1c1
Sequence:CCGGGAAGTGGTCAGCCTATGGTTTCTCGAGAAACCATAGGCTGACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163136    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182619.1-1819s1c1
Sequence:CCGGGATTGGGAAGATGGGCTTCAACTCGAGTTGAAGCCCATCTTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks