EMAIL THIS PAGE TO A FRIEND

CLEC18B

C-type lectin domain family 18, member B

13 Gene Product Result for
Synonyms: MRCL2
Species: Human CLEC18B(497190)
UniProtKB ID: Q6UXF7, B4DF90
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011880 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011880 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083107 predicted 872
2 SASI_Hs01_00083108 predicted 1602
3 SASI_Hs01_00083109 predicted 1427
4 SASI_Hs02_00306045 predicted 470
5 SASI_Hs01_00083110 predicted 644
6 SASI_Hs01_00083111 predicted 573
7 SASI_Hs01_00083112 predicted 743
8 SASI_Hs01_00083113 predicted 1149
9 SASI_Hs01_00083114 predicted 557
10 SASI_Hs01_00083115 predicted 1576
11 SASI_Hs01_00083116 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011880
CLEC18B MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 18, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011880.1-1613s1c1
Sequence:CCGGCCTTGCACAATGCCAGAAGTTCTCGAGAACTTCTGGCATTGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-1063s1c1
Sequence:CCGGCTTCAGAGGCAGACACCTATTCTCGAGAATAGGTGTCTGCCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-257s1c1
Sequence:CCGGGAAGGAGAGTTTCTTGCTCCTCTCGAGAGGAGCAAGAAACTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-1429s1c1
Sequence:CCGGGAAACCGTTACATCTGCCAGTCTCGAGACTGGCAGATGTAACGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-486s1c1
Sequence:CCGGGAAGTGGTCAGCCTATGGTTTCTCGAGAAACCATAGGCTGACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011880.1-1711s1c1
Sequence:CCGGGATTGGGAAGATGGGCTTCAACTCGAGTTGAAGCCCATCTTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-251s1c1
Sequence:CCGGGAACAGGAAGGAGAGTTTCTTCTCGAGAAGAAACTCTCCTTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-636s1c1
Sequence:CCGGCAGACAGCGATAGAAGCCTTTCTCGAGAAAGGCTTCTATCGCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-248s1c1
Sequence:CCGGCCTGAACAGGAAGGAGAGTTTCTCGAGAAACTCTCCTTCCTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011880
CLEC18B MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 18, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011880.1-1613s1c1
Sequence:CCGGCCTTGCACAATGCCAGAAGTTCTCGAGAACTTCTGGCATTGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-1063s1c1
Sequence:CCGGCTTCAGAGGCAGACACCTATTCTCGAGAATAGGTGTCTGCCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-257s1c1
Sequence:CCGGGAAGGAGAGTTTCTTGCTCCTCTCGAGAGGAGCAAGAAACTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-1429s1c1
Sequence:CCGGGAAACCGTTACATCTGCCAGTCTCGAGACTGGCAGATGTAACGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-486s1c1
Sequence:CCGGGAAGTGGTCAGCCTATGGTTTCTCGAGAAACCATAGGCTGACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011880.1-1711s1c1
Sequence:CCGGGATTGGGAAGATGGGCTTCAACTCGAGTTGAAGCCCATCTTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-251s1c1
Sequence:CCGGGAACAGGAAGGAGAGTTTCTTCTCGAGAAGAAACTCTCCTTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-636s1c1
Sequence:CCGGCAGACAGCGATAGAAGCCTTTCTCGAGAAAGGCTTCTATCGCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-248s1c1
Sequence:CCGGCCTGAACAGGAAGGAGAGTTTCTCGAGAAACTCTCCTTCCTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011880
CLEC18B MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 18, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011880.1-1613s1c1
Sequence:CCGGCCTTGCACAATGCCAGAAGTTCTCGAGAACTTCTGGCATTGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-1063s1c1
Sequence:CCGGCTTCAGAGGCAGACACCTATTCTCGAGAATAGGTGTCTGCCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-257s1c1
Sequence:CCGGGAAGGAGAGTTTCTTGCTCCTCTCGAGAGGAGCAAGAAACTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-1429s1c1
Sequence:CCGGGAAACCGTTACATCTGCCAGTCTCGAGACTGGCAGATGTAACGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-486s1c1
Sequence:CCGGGAAGTGGTCAGCCTATGGTTTCTCGAGAAACCATAGGCTGACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011880.1-1711s1c1
Sequence:CCGGGATTGGGAAGATGGGCTTCAACTCGAGTTGAAGCCCATCTTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-251s1c1
Sequence:CCGGGAACAGGAAGGAGAGTTTCTTCTCGAGAAGAAACTCTCCTTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-636s1c1
Sequence:CCGGCAGACAGCGATAGAAGCCTTTCTCGAGAAAGGCTTCTATCGCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011880.1-248s1c1
Sequence:CCGGCCTGAACAGGAAGGAGAGTTTCTCGAGAAACTCTCCTTCCTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks