EMAIL THIS PAGE TO A FRIEND

CLEC18C

C-type lectin domain family 18, member C

42 Gene Product Result for
Synonyms: MRCL MRCL3
Species: Human CLEC18C(283971), naked mole-rat Clec18c(101716806)
UniProtKB ID: Q8NCF0, Q8IUW8
Gene ID:
naked mole-rat(101716806) C-type lectin domain family 18, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173619 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173619 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132950 predicted 1004
2 SASI_Hs01_00132951 predicted 1699
3 SASI_Hs01_00132952 predicted 1529
4 SASI_Hs02_00368493 predicted 604
5 SASI_Hs01_00132953 predicted 775
6 SASI_Hs01_00132954 predicted 704
7 SASI_Hs01_00132955 predicted 873
8 SASI_Hs01_00132956 predicted 1274
9 SASI_Hs01_00132957 predicted 695
10 SASI_Hs01_00132958 predicted 1682
11 SASI_Hs01_00132959 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173619
CLEC18C MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 18, member C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.1-1195s1c1
Sequence:CCGGCTTCAGAGGCAGACACCTATTCTCGAGAATAGGTGTCTGCCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.2-1223s1c1
Sequence:CCGGCAGGATGAAATGTCAGAGGAACTCGAGTTCCTCTGACATTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158572    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173619.2-1940s1c1
Sequence:CCGGCCACAGGGTATTAAATTATGACTCGAGTCATAATTTAATACCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.1-1217s1c1
Sequence:CCGGCAGAGCCAGGATGAAATGTCACTCGAGTGACATTTCATCCTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.1-1222s1c1
Sequence:CCGGCCAGGATGAAATGTCAGGTGACTCGAGTCACCTGACATTTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173619.2-1818s21c1
Sequence:CCGGTTGGGAAGATGGGCTTCAATTCTCGAGAATTGAAGCCCATCTTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173619.2-1315s21c1
Sequence:CCGGAGACCACCAACGAGGTGATTGCTCGAGCAATCACCTCGTTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173619.2-1537s21c1
Sequence:CCGGACCGTTACATCTGCCAGTTTGCTCGAGCAAACTGGCAGATGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173619
CLEC18C MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 18, member C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.1-1195s1c1
Sequence:CCGGCTTCAGAGGCAGACACCTATTCTCGAGAATAGGTGTCTGCCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.2-1223s1c1
Sequence:CCGGCAGGATGAAATGTCAGAGGAACTCGAGTTCCTCTGACATTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158572    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173619.2-1940s1c1
Sequence:CCGGCCACAGGGTATTAAATTATGACTCGAGTCATAATTTAATACCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.1-1217s1c1
Sequence:CCGGCAGAGCCAGGATGAAATGTCACTCGAGTGACATTTCATCCTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.1-1222s1c1
Sequence:CCGGCCAGGATGAAATGTCAGGTGACTCGAGTCACCTGACATTTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173619.2-1818s21c1
Sequence:CCGGTTGGGAAGATGGGCTTCAATTCTCGAGAATTGAAGCCCATCTTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173619.2-1315s21c1
Sequence:CCGGAGACCACCAACGAGGTGATTGCTCGAGCAATCACCTCGTTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173619.2-1537s21c1
Sequence:CCGGACCGTTACATCTGCCAGTTTGCTCGAGCAAACTGGCAGATGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173619
CLEC18C MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 18, member C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.1-1195s1c1
Sequence:CCGGCTTCAGAGGCAGACACCTATTCTCGAGAATAGGTGTCTGCCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.2-1223s1c1
Sequence:CCGGCAGGATGAAATGTCAGAGGAACTCGAGTTCCTCTGACATTTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158572    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173619.2-1940s1c1
Sequence:CCGGCCACAGGGTATTAAATTATGACTCGAGTCATAATTTAATACCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.1-1217s1c1
Sequence:CCGGCAGAGCCAGGATGAAATGTCACTCGAGTGACATTTCATCCTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173619.1-1222s1c1
Sequence:CCGGCCAGGATGAAATGTCAGGTGACTCGAGTCACCTGACATTTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173619.2-1818s21c1
Sequence:CCGGTTGGGAAGATGGGCTTCAATTCTCGAGAATTGAAGCCCATCTTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173619.2-1315s21c1
Sequence:CCGGAGACCACCAACGAGGTGATTGCTCGAGCAATCACCTCGTTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173619.2-1537s21c1
Sequence:CCGGACCGTTACATCTGCCAGTTTGCTCGAGCAAACTGGCAGATGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks