EMAIL THIS PAGE TO A FRIEND

CLEC1A

C-type lectin domain family 1, member A

67 Gene Product Result for
Synonyms: CLEC1
UniProtKB ID: Q8NC01, Q8IUW7, Q9NZH3
Gene ID:
Human(51267) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded protein may play a role in regulating dendritic cell function. Alternative splice variants have been described but their biological nature has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
Mouse(243653) C-type lectin domain family 1, member a
Rat(500337) C-type lectin domain family 1, member A
dog(486695) C-type lectin domain family 1, member A
domestic cat(101085986) C-type lectin domain family 1, member A
cow(536944) C-type lectin domain family 1, member A
sheep(101118775) C-type lectin domain family 1, member A
naked mole-rat(101706004) C-type lectin domain family 1, member A
domestic guinea pig(100724656) C-type lectin domain family 1, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1373 Human CLEC-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016511 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042941 MISSION® esiRNA esiRNA human CLEC1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016511 Rosetta Predictions human pricing
NM_001109253 Rosetta Predictions rat pricing
NM_175526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098998 predicted 362
2 SASI_Hs01_00098999 predicted 1020
3 SASI_Hs01_00099000 predicted 976
4 SASI_Hs01_00099002 predicted 483
5 SASI_Hs01_00099003 predicted 832
6 SASI_Hs01_00099004 predicted 515
7 SASI_Hs01_00099006 predicted 967
8 SASI_Hs02_00349601 predicted 322
9 SASI_Hs02_00349602 predicted 990
10 SASI_Hs01_00098997 predicted 983
11 SASI_Hs01_00099001 predicted 1009
12 SASI_Hs01_00099005 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246594 predicted 559
2 SASI_Rn02_00246595 predicted 1179
3 SASI_Rn02_00246596 predicted 1094
4 SASI_Rn02_00246597 predicted 922
5 SASI_Rn02_00246598 predicted 1001
6 SASI_Rn02_00246599 predicted 791
7 SASI_Rn02_00246600 predicted 1144
8 SASI_Rn02_00246601 predicted 666
9 SASI_Rn02_00246602 predicted 711
10 SASI_Rn02_00246603 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129507 predicted 528
2 SASI_Mm02_00346468 predicted 383
3 SASI_Mm01_00129508 predicted 1083
4 SASI_Mm01_00129509 predicted 787
5 SASI_Mm01_00129510 predicted 535
6 SASI_Mm01_00129511 predicted 833
7 SASI_Mm01_00129512 predicted 986
8 SASI_Mm01_00129514 predicted 978
9 SASI_Mm01_00129515 predicted 531
10 SASI_Mm01_00129516 predicted 1153
11 SASI_Mm01_00129513 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175526
CLEC1A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 1, member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175526.3-621s21c1
Sequence:CCGGTCTACAGCAGGTAGCCGTAAACTCGAGTTTACGGCTACCTGCTGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175526.3-1391s21c1
Sequence:CCGGTCTCAGGGTCTAGACGTTATCCTCGAGGATAACGTCTAGACCCTGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175526.3-1471s21c1
Sequence:CCGGAGTTGATACAAAGCCACAAACCTCGAGGTTTGTGGCTTTGTATCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175526.3-1293s21c1
Sequence:CCGGTCTAGACACAAAGGGTCTTATCTCGAGATAAGACCCTTTGTGTCTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175526.3-332s21c1
Sequence:CCGGATACCACCATAAGCCTGTATTCTCGAGAATACAGGCTTATGGTGGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-834s1c1
Sequence:CCGGGCTTACTCTAAGGACTGCAAACTCGAGTTTGCAGTCCTTAGAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-750s1c1
Sequence:CCGGCCTTACTCCTTTGAACTGTTTCTCGAGAAACAGTTCAAAGGAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-335s1c1
Sequence:CCGGGCTGTCTAATATCCAGCAAGACTCGAGTCTTGCTGGATATTAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175526.1-1327s1c1
Sequence:CCGGCCACATAACTATTGGTCCTTTCTCGAGAAAGGACCAATAGTTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-540s1c1
Sequence:CCGGGACAAATGTTACCAGTTCTATCTCGAGATAGAACTGGTAACATTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175526
CLEC1A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 1, member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175526.3-621s21c1
Sequence:CCGGTCTACAGCAGGTAGCCGTAAACTCGAGTTTACGGCTACCTGCTGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175526.3-1391s21c1
Sequence:CCGGTCTCAGGGTCTAGACGTTATCCTCGAGGATAACGTCTAGACCCTGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175526.3-1471s21c1
Sequence:CCGGAGTTGATACAAAGCCACAAACCTCGAGGTTTGTGGCTTTGTATCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175526.3-1293s21c1
Sequence:CCGGTCTAGACACAAAGGGTCTTATCTCGAGATAAGACCCTTTGTGTCTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175526.3-332s21c1
Sequence:CCGGATACCACCATAAGCCTGTATTCTCGAGAATACAGGCTTATGGTGGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-834s1c1
Sequence:CCGGGCTTACTCTAAGGACTGCAAACTCGAGTTTGCAGTCCTTAGAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-750s1c1
Sequence:CCGGCCTTACTCCTTTGAACTGTTTCTCGAGAAACAGTTCAAAGGAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-335s1c1
Sequence:CCGGGCTGTCTAATATCCAGCAAGACTCGAGTCTTGCTGGATATTAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175526.1-1327s1c1
Sequence:CCGGCCACATAACTATTGGTCCTTTCTCGAGAAAGGACCAATAGTTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-540s1c1
Sequence:CCGGGACAAATGTTACCAGTTCTATCTCGAGATAGAACTGGTAACATTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175526
CLEC1A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 1, member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175526.3-621s21c1
Sequence:CCGGTCTACAGCAGGTAGCCGTAAACTCGAGTTTACGGCTACCTGCTGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175526.3-1391s21c1
Sequence:CCGGTCTCAGGGTCTAGACGTTATCCTCGAGGATAACGTCTAGACCCTGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175526.3-1471s21c1
Sequence:CCGGAGTTGATACAAAGCCACAAACCTCGAGGTTTGTGGCTTTGTATCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175526.3-1293s21c1
Sequence:CCGGTCTAGACACAAAGGGTCTTATCTCGAGATAAGACCCTTTGTGTCTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175526.3-332s21c1
Sequence:CCGGATACCACCATAAGCCTGTATTCTCGAGAATACAGGCTTATGGTGGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-834s1c1
Sequence:CCGGGCTTACTCTAAGGACTGCAAACTCGAGTTTGCAGTCCTTAGAGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-750s1c1
Sequence:CCGGCCTTACTCCTTTGAACTGTTTCTCGAGAAACAGTTCAAAGGAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-335s1c1
Sequence:CCGGGCTGTCTAATATCCAGCAAGACTCGAGTCTTGCTGGATATTAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175526.1-1327s1c1
Sequence:CCGGCCACATAACTATTGGTCCTTTCTCGAGAAAGGACCAATAGTTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175526.1-540s1c1
Sequence:CCGGGACAAATGTTACCAGTTCTATCTCGAGATAGAACTGGTAACATTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016511
CLEC1A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 1, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016511.2-1249s21c1
Sequence:CCGGCCTTACACTTGGTGGAATAAGCTCGAGCTTATTCCACCAAGTGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016511.2-522s21c1
Sequence:CCGGCAATTGCTACCAGTTCTATAACTCGAGTTATAGAACTGGTAGCAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-729s1c1
Sequence:CCGGCCCTTTCACTTCTGAACTGTTCTCGAGAACAGTTCAGAAGTGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-797s1c1
Sequence:CCGGCCATCCTTAATGGGATGATCTCTCGAGAGATCATCCCATTAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-315s1c1
Sequence:CCGGGCTCTCCAATACTGGTCAAGACTCGAGTCTTGACCAGTATTGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-611s1c1
Sequence:CCGGACAAACAAGAAGACCTGGAATCTCGAGATTCCAGGTCTTCTTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-485s1c1
Sequence:CCGGGCAGCCCTTGTACAGAACAATCTCGAGATTGTTCTGTACAAGGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016511
CLEC1A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 1, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016511.2-1249s21c1
Sequence:CCGGCCTTACACTTGGTGGAATAAGCTCGAGCTTATTCCACCAAGTGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016511.2-522s21c1
Sequence:CCGGCAATTGCTACCAGTTCTATAACTCGAGTTATAGAACTGGTAGCAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-729s1c1
Sequence:CCGGCCCTTTCACTTCTGAACTGTTCTCGAGAACAGTTCAGAAGTGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-797s1c1
Sequence:CCGGCCATCCTTAATGGGATGATCTCTCGAGAGATCATCCCATTAAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-315s1c1
Sequence:CCGGGCTCTCCAATACTGGTCAAGACTCGAGTCTTGACCAGTATTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-611s1c1
Sequence:CCGGACAAACAAGAAGACCTGGAATCTCGAGATTCCAGGTCTTCTTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-485s1c1
Sequence:CCGGGCAGCCCTTGTACAGAACAATCTCGAGATTGTTCTGTACAAGGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016511
CLEC1A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 1, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016511.2-1249s21c1
Sequence:CCGGCCTTACACTTGGTGGAATAAGCTCGAGCTTATTCCACCAAGTGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016511.2-522s21c1
Sequence:CCGGCAATTGCTACCAGTTCTATAACTCGAGTTATAGAACTGGTAGCAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-729s1c1
Sequence:CCGGCCCTTTCACTTCTGAACTGTTCTCGAGAACAGTTCAGAAGTGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-797s1c1
Sequence:CCGGCCATCCTTAATGGGATGATCTCTCGAGAGATCATCCCATTAAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-315s1c1
Sequence:CCGGGCTCTCCAATACTGGTCAAGACTCGAGTCTTGACCAGTATTGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-611s1c1
Sequence:CCGGACAAACAAGAAGACCTGGAATCTCGAGATTCCAGGTCTTCTTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016511.2-485s1c1
Sequence:CCGGGCAGCCCTTGTACAGAACAATCTCGAGATTGTTCTGTACAAGGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)