EMAIL THIS PAGE TO A FRIEND

CLEC1B

C-type lectin domain family 1, member B

152 Gene Product Result for
Synonyms: 1810061I13Rik CLEC2 CLEC2B PRO1384 QDED721
UniProtKB ID: Q9P126, Q6UWX7, Q8NHR6
Gene ID:
Human(51266) Summary: Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 (KLRD1; MIM 602894) and NKG2D (KLRC4; MIM 602893), that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 is a C-type lectin-like receptor expressed in myeloid cells and NK cells (Colonna et al., 2000 [PubMed 10671229]
Mouse(56760) C-type lectin domain family 1, member b
Rat(500336) C-type lectin domain family 1, member B
domestic guinea pig(100726289) C-type lectin domain family 1, member B
sheep(101119293) C-type lectin domain family 1, member B
dog(486696) C-type lectin domain family 1, member B
cow(784092) C-type lectin domain family 1, member B
domestic cat(101083272) C-type lectin domain family 1, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1374 Human CLEC-2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016509 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069271 MISSION® esiRNA esiRNA human CLEC1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099431 Rosetta Predictions human pricing
NM_016509 Rosetta Predictions human pricing
XM_001068837 Rosetta Predictions rat pricing
XM_575687 Rosetta Predictions rat pricing
NM_019985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320689 predicted 612
2 SASI_Hs02_00320690 predicted 575
3 SASI_Hs02_00320691 predicted 538
4 SASI_Hs02_00320692 predicted 517
5 SASI_Hs02_00320693 predicted 526
6 SASI_Hs02_00320694 predicted 611
7 SASI_Hs02_00320695 predicted 610
8 SASI_Hs02_00320696 predicted 568
9 SASI_Hs02_00320697 predicted 558
10 SASI_Hs02_00320698 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349587 predicted 707
2 SASI_Hs02_00349588 predicted 675
3 SASI_Hs01_00161167 predicted 642
4 SASI_Hs01_00161173 predicted 616
5 SASI_Hs02_00349589 predicted 629
6 SASI_Hs02_00349590 predicted 714
7 SASI_Hs02_00349591 predicted 708
8 SASI_Hs02_00349592 predicted 668
9 SASI_Hs02_00349593 predicted 650
10 SASI_Hs02_00349594 predicted 618
11 SASI_Hs01_00161165 predicted 459
12 SASI_Hs01_00161166 predicted 443
13 SASI_Hs01_00161168 predicted 411
14 SASI_Hs01_00161169 predicted 367
15 SASI_Hs01_00161170 predicted 488
16 SASI_Hs01_00161171 predicted 346
17 SASI_Hs01_00161172 predicted 397
18 SASI_Hs01_00161174 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326088 predicted 293
2 SASI_Rn02_00326089 predicted 203
3 SASI_Rn02_00326090 predicted 405
4 SASI_Rn02_00326091 predicted 485
5 SASI_Rn02_00326092 predicted 415
6 SASI_Rn02_00326093 predicted 331
7 SASI_Rn02_00326094 predicted 430
8 SASI_Rn02_00326095 predicted 493
9 SASI_Rn02_00326096 predicted 244
10 SASI_Rn02_00326097 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404110 predicted 399
2 SASI_Rn02_00404111 predicted 404
3 SASI_Rn02_00404112 predicted 398
4 SASI_Rn02_00404113 predicted 409
5 SASI_Rn02_00404114 predicted 402
6 SASI_Rn02_00404115 predicted 452
7 SASI_Rn02_00404116 predicted 448
8 SASI_Rn02_00404117 predicted 430
9 SASI_Rn02_00404118 predicted 493
10 SASI_Rn02_00404119 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081532 predicted 325
2 SASI_Mm01_00081533 predicted 634
3 SASI_Mm01_00081534 predicted 747
4 SASI_Mm01_00081535 predicted 694
5 SASI_Mm01_00081536 predicted 855
6 SASI_Mm01_00081537 predicted 644
7 SASI_Mm01_00081538 predicted 852
8 SASI_Mm01_00081539 predicted 666
9 SASI_Mm01_00081540 predicted 550
10 SASI_Mm01_00081541 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016509
CLEC1B MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 1, member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-456s1c1
Sequence:CCGGGCACTTTCAAAGGTCATAAATCTCGAGATTTATGACCTTTGAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-793s1c1
Sequence:CCGGCCCTACCTTCTGTGAGAACAACTCGAGTTGTTCTCACAGAAGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-633s1c1
Sequence:CCGGCCAGGACTCATTTAATTCGTTCTCGAGAACGAATTAAATGAGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-417s1c1
Sequence:CCGGGCTTCTGTCAATATGTGGTAACTCGAGTTACCACATATTGACAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-607s1c1
Sequence:CCGGCCGGAACATTGTGGAGTACATCTCGAGATGTACTCCACAATGTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016509.3-361s21c1
Sequence:CCGGGGTCTGTCATGCAGCGCAATTCTCGAGAATTGCGCTGCATGACAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016509.3-717s21c1
Sequence:CCGGGAGGATGGCTCGGTTATCTCACTCGAGTGAGATAACCGAGCCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016509
CLEC1B MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 1, member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-456s1c1
Sequence:CCGGGCACTTTCAAAGGTCATAAATCTCGAGATTTATGACCTTTGAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-793s1c1
Sequence:CCGGCCCTACCTTCTGTGAGAACAACTCGAGTTGTTCTCACAGAAGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-633s1c1
Sequence:CCGGCCAGGACTCATTTAATTCGTTCTCGAGAACGAATTAAATGAGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-417s1c1
Sequence:CCGGGCTTCTGTCAATATGTGGTAACTCGAGTTACCACATATTGACAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-607s1c1
Sequence:CCGGCCGGAACATTGTGGAGTACATCTCGAGATGTACTCCACAATGTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016509.3-361s21c1
Sequence:CCGGGGTCTGTCATGCAGCGCAATTCTCGAGAATTGCGCTGCATGACAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016509.3-717s21c1
Sequence:CCGGGAGGATGGCTCGGTTATCTCACTCGAGTGAGATAACCGAGCCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016509
CLEC1B MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 1, member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-456s1c1
Sequence:CCGGGCACTTTCAAAGGTCATAAATCTCGAGATTTATGACCTTTGAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-793s1c1
Sequence:CCGGCCCTACCTTCTGTGAGAACAACTCGAGTTGTTCTCACAGAAGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-633s1c1
Sequence:CCGGCCAGGACTCATTTAATTCGTTCTCGAGAACGAATTAAATGAGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-417s1c1
Sequence:CCGGGCTTCTGTCAATATGTGGTAACTCGAGTTACCACATATTGACAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016509.2-607s1c1
Sequence:CCGGCCGGAACATTGTGGAGTACATCTCGAGATGTACTCCACAATGTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016509.3-361s21c1
Sequence:CCGGGGTCTGTCATGCAGCGCAATTCTCGAGAATTGCGCTGCATGACAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016509.3-717s21c1
Sequence:CCGGGAGGATGGCTCGGTTATCTCACTCGAGTGAGATAACCGAGCCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019985
CLEC1B MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 1, member B
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-557s1c1
Sequence:CCGGGCCAAGAGTTGATTAGACAATCTCGAGATTGTCTAATCAACTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-810s1c1
Sequence:CCGGGAACTCTAAGAAAGACTGGATCTCGAGATCCAGTCTTTCTTAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-546s1c1
Sequence:CCGGCAAGAAATTCTGCCAAGAGTTCTCGAGAACTCTTGGCAGAATTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-415s1c1
Sequence:CCGGGCTTTAGTTCTGCTGATCTCACTCGAGTGAGATCAGCAGAACTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-672s1c1
Sequence:CCGGGCGTAACCTAACATGGGAAGACTCGAGTCTTCCCATGTTAGGTTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019985.2-714s1c1
Sequence:CCGGGCAGAATGCAACACTTGTGAACTCGAGTTCACAAGTGTTGCATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019985.2-792s1c1
Sequence:CCGGGATTGGATTATCACGCCAGAACTCGAGTTCTGGCGTGATAATCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019985.2-902s1c1
Sequence:CCGGGTGCTTATCTTCATAATGGAACTCGAGTTCCATTATGAAGATAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019985.2-633s21c1
Sequence:CCGGGTGGAGATACCATGGAGATAGCTCGAGCTATCTCCATGGTATCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019985.2-781s21c1
Sequence:CCGGTCAGTCCGTTGGATTGGATTACTCGAGTAATCCAATCCAACGGACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019985.2-897s21c1
Sequence:CCGGGAATTGTGCTTATCTTCATAACTCGAGTTATGAAGATAAGCACAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019985
CLEC1B MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 1, member B
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-557s1c1
Sequence:CCGGGCCAAGAGTTGATTAGACAATCTCGAGATTGTCTAATCAACTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-810s1c1
Sequence:CCGGGAACTCTAAGAAAGACTGGATCTCGAGATCCAGTCTTTCTTAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-546s1c1
Sequence:CCGGCAAGAAATTCTGCCAAGAGTTCTCGAGAACTCTTGGCAGAATTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-415s1c1
Sequence:CCGGGCTTTAGTTCTGCTGATCTCACTCGAGTGAGATCAGCAGAACTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-672s1c1
Sequence:CCGGGCGTAACCTAACATGGGAAGACTCGAGTCTTCCCATGTTAGGTTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019985.2-714s1c1
Sequence:CCGGGCAGAATGCAACACTTGTGAACTCGAGTTCACAAGTGTTGCATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019985.2-792s1c1
Sequence:CCGGGATTGGATTATCACGCCAGAACTCGAGTTCTGGCGTGATAATCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019985.2-902s1c1
Sequence:CCGGGTGCTTATCTTCATAATGGAACTCGAGTTCCATTATGAAGATAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019985.2-633s21c1
Sequence:CCGGGTGGAGATACCATGGAGATAGCTCGAGCTATCTCCATGGTATCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019985.2-781s21c1
Sequence:CCGGTCAGTCCGTTGGATTGGATTACTCGAGTAATCCAATCCAACGGACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019985.2-897s21c1
Sequence:CCGGGAATTGTGCTTATCTTCATAACTCGAGTTATGAAGATAAGCACAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019985
CLEC1B MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 1, member B
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-557s1c1
Sequence:CCGGGCCAAGAGTTGATTAGACAATCTCGAGATTGTCTAATCAACTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-810s1c1
Sequence:CCGGGAACTCTAAGAAAGACTGGATCTCGAGATCCAGTCTTTCTTAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-546s1c1
Sequence:CCGGCAAGAAATTCTGCCAAGAGTTCTCGAGAACTCTTGGCAGAATTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-415s1c1
Sequence:CCGGGCTTTAGTTCTGCTGATCTCACTCGAGTGAGATCAGCAGAACTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019985.2-672s1c1
Sequence:CCGGGCGTAACCTAACATGGGAAGACTCGAGTCTTCCCATGTTAGGTTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019985.2-714s1c1
Sequence:CCGGGCAGAATGCAACACTTGTGAACTCGAGTTCACAAGTGTTGCATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019985.2-792s1c1
Sequence:CCGGGATTGGATTATCACGCCAGAACTCGAGTTCTGGCGTGATAATCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019985.2-902s1c1
Sequence:CCGGGTGCTTATCTTCATAATGGAACTCGAGTTCCATTATGAAGATAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019985.2-633s21c1
Sequence:CCGGGTGGAGATACCATGGAGATAGCTCGAGCTATCTCCATGGTATCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019985.2-781s21c1
Sequence:CCGGTCAGTCCGTTGGATTGGATTACTCGAGTAATCCAATCCAACGGACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019985.2-897s21c1
Sequence:CCGGGAATTGTGCTTATCTTCATAACTCGAGTTATGAAGATAAGCACAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)