EMAIL THIS PAGE TO A FRIEND

CLEC2B

C-type lectin domain family 2, member B

24 Gene Product Result for
Synonyms: AICL CLECSF2 HP10085 IFNRG1
UniProtKB ID: Q92478, B2R9U1, Q8IZE9, Q9BS74, Q9UQB4
Gene ID:
Human(9976) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may function as a cell activation antigen. An alternative splice variant has been described but its full-length sequence has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
sheep(101120999) C-type lectin domain family 2, member B
cow(100297496) C-type lectin domain family 2, member B
domestic cat(101084719) C-type lectin domain family 2, member B
dog(611423) C-type lectin domain family 2, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005127 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016291 MISSION® esiRNA esiRNA targeting human CLEC2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005127 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219198 predicted 1045
2 SASI_Hs02_00339041 predicted 967
3 SASI_Hs01_00219201 predicted 1053
4 SASI_Hs01_00219202 predicted 814
5 SASI_Hs01_00219203 predicted 988
6 SASI_Hs01_00219205 predicted 702
7 SASI_Hs01_00219206 predicted 1027
8 SASI_Hs01_00219207 predicted 730
9 SASI_Hs02_00339042 predicted 762
10 SASI_Hs02_00339043 predicted 980
11 SASI_Hs01_00219199 predicted 823
12 SASI_Hs01_00219200 predicted 866
13 SASI_Hs01_00219204 predicted 911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005127
VALIDATED
CLEC2B MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 2, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005127.2-861s1c1
Sequence:CCGGCGACCTAACTATAATTGACAACTCGAGTTGTCAATTATAGTTAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005127.2-982s1c1
Sequence:CCGGGCTACATTTACCAAATCGTTTCTCGAGAAACGATTTGGTAAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005127.2-1055s1c1
Sequence:CCGGCAGCTAGATGTTACACCGAAACTCGAGTTTCGGTGTAACATCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005127.2-907s1c1
Sequence:CCGGCGGTATAAATGCAGTTCTGATCTCGAGATCAGAACTGCATTTATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005127.2-740s1c1
Sequence:CCGGCTCGAGATTCTCAGAGTTTATCTCGAGATAAACTCTGAGAATCTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005127
VALIDATED
CLEC2B MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 2, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005127.2-861s1c1
Sequence:CCGGCGACCTAACTATAATTGACAACTCGAGTTGTCAATTATAGTTAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005127.2-982s1c1
Sequence:CCGGGCTACATTTACCAAATCGTTTCTCGAGAAACGATTTGGTAAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005127.2-1055s1c1
Sequence:CCGGCAGCTAGATGTTACACCGAAACTCGAGTTTCGGTGTAACATCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005127.2-907s1c1
Sequence:CCGGCGGTATAAATGCAGTTCTGATCTCGAGATCAGAACTGCATTTATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005127.2-740s1c1
Sequence:CCGGCTCGAGATTCTCAGAGTTTATCTCGAGATAAACTCTGAGAATCTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005127
VALIDATED
CLEC2B MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 2, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005127.2-861s1c1
Sequence:CCGGCGACCTAACTATAATTGACAACTCGAGTTGTCAATTATAGTTAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005127.2-982s1c1
Sequence:CCGGGCTACATTTACCAAATCGTTTCTCGAGAAACGATTTGGTAAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005127.2-1055s1c1
Sequence:CCGGCAGCTAGATGTTACACCGAAACTCGAGTTTCGGTGTAACATCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005127.2-907s1c1
Sequence:CCGGCGGTATAAATGCAGTTCTGATCTCGAGATCAGAACTGCATTTATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005127.2-740s1c1
Sequence:CCGGCTCGAGATTCTCAGAGTTTATCTCGAGATAAACTCTGAGAATCTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks