EMAIL THIS PAGE TO A FRIEND

CLEC2D

C-type lectin domain family 2, member D

190 Gene Product Result for
Synonyms: CLAX LLT1 OCIL
Gene ID:
Human(29121) Summary: This gene encodes a member of the natural killer cell receptor C-type lectin family. The encoded protein inhibits osteoclast formation and contains a transmembrane domain near the N-terminus as well as the C-type lectin-like extracellular domain. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Oct 2010]
Mouse(93694) C-type lectin domain family 2, member d
Rat(113937) C-type lectin domain family 2, member D
cow(617565) C-type lectin domain family 2, member D
domestic cat(101082245) C-type lectin domain family 2, member D
dog(611449) C-type lectin domain family 2, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004419 Rosetta Predictions human pricing
NM_001004420 Rosetta Predictions human pricing
NM_013269 Rosetta Predictions human pricing
NM_130402 Rosetta Predictions rat pricing
NM_053109 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236153 predicted 209
2 SASI_Hs02_00304581 predicted 205
3 SASI_Hs02_00304582 predicted 210
4 SASI_Hs02_00304583 predicted 245
5 SASI_Hs02_00304584 predicted 241
6 SASI_Hs01_00236151 predicted 25
7 SASI_Hs01_00236152 predicted 644
8 SASI_Hs02_00304585 predicted 646
9 SASI_Hs01_00236154 predicted 42
10 SASI_Hs01_00236155 predicted 112
11 SASI_Hs01_00236156 predicted 395
12 SASI_Hs01_00236157 predicted 438
13 SASI_Hs01_00236158 predicted 155
14 SASI_Hs01_00236159 predicted 331
15 SASI_Hs01_00236160 predicted 47
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065010 predicted 116
2 SASI_Hs01_00065011 predicted 213
3 SASI_Hs01_00065012 predicted 435
4 SASI_Hs01_00065013 predicted 48
5 SASI_Hs01_00065014 predicted 124
6 SASI_Hs01_00065015 predicted 465
7 SASI_Hs01_00065016 predicted 213
8 SASI_Hs01_00065017 predicted 330
9 SASI_Hs01_00065018 predicted 49
10 SASI_Hs01_00065019 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094361 predicted 211
2 SASI_Hs01_00094367 predicted 210
3 SASI_Hs02_00344504 predicted 215
4 SASI_Hs02_00344505 predicted 247
5 SASI_Hs02_00344506 predicted 240
6 SASI_Hs01_00094358 predicted 28
7 SASI_Hs01_00094359 predicted 561
8 SASI_Hs01_00094360 predicted 627
9 SASI_Hs01_00094362 predicted 559
10 SASI_Hs01_00094363 predicted 42
11 SASI_Hs01_00094364 predicted 117
12 SASI_Hs01_00094365 predicted 389
13 SASI_Hs01_00094366 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067181 predicted 209
2 SASI_Rn02_00267382 predicted 223
3 SASI_Rn02_00267383 predicted 202
4 SASI_Rn02_00267384 predicted 227
5 SASI_Rn02_00267385 predicted 211
6 SASI_Rn02_00267386 predicted 233
7 SASI_Rn02_00267387 predicted 208
8 SASI_Rn02_00267388 predicted 378
9 SASI_Rn01_00067186 predicted 553
10 SASI_Rn01_00067187 predicted 553
11 SASI_Rn01_00067179 predicted 577
12 SASI_Rn01_00067180 predicted 910
13 SASI_Rn01_00067182 predicted 904
14 SASI_Rn01_00067183 predicted 490
15 SASI_Rn01_00067184 predicted 941
16 SASI_Rn01_00067185 predicted 357
17 SASI_Rn01_00067188 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106330 predicted 550
2 SASI_Mm01_00106331 predicted 552
3 SASI_Mm01_00106332 predicted 515
4 SASI_Mm01_00106333 predicted 754
5 SASI_Mm01_00106334 predicted 594
6 SASI_Mm01_00106336 predicted 75
7 SASI_Mm01_00106337 predicted 179
8 SASI_Mm01_00106335 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013269
CLEC2D MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 2, member D
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013269.1-606s1c1
Sequence:CCGGCCAACTAATCTTTAGAAGCATCTCGAGATGCTTCTAAAGATTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013269.1-238s1c1
Sequence:CCGGCCCAGAAAGCTGGATTGGTTTCTCGAGAAACCAATCCAGCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013269.1-107s1c1
Sequence:CCGGGCTACCTTAATTTGGCGCTTACTCGAGTAAGCGCCAAATTAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013269.1-500s1c1
Sequence:CCGGTGTGCCTATTTGAATGACAAACTCGAGTTTGTCATTCAAATAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013269.3-180s21c1
Sequence:CCGGTTGCTGCTTTAAGCGCAATAACTCGAGTTATTGCGCTTAAAGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013269.3-443s21c1
Sequence:CCGGCAACCATGGAAATGGATAAATCTCGAGATTTATCCATTTCCATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013269.3-950s21c1
Sequence:CCGGGTGCACAGGAACTCCTATTTACTCGAGTAAATAGGAGTTCCTGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013269
CLEC2D MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 2, member D
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013269.1-606s1c1
Sequence:CCGGCCAACTAATCTTTAGAAGCATCTCGAGATGCTTCTAAAGATTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013269.1-238s1c1
Sequence:CCGGCCCAGAAAGCTGGATTGGTTTCTCGAGAAACCAATCCAGCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013269.1-107s1c1
Sequence:CCGGGCTACCTTAATTTGGCGCTTACTCGAGTAAGCGCCAAATTAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013269.1-500s1c1
Sequence:CCGGTGTGCCTATTTGAATGACAAACTCGAGTTTGTCATTCAAATAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013269.3-180s21c1
Sequence:CCGGTTGCTGCTTTAAGCGCAATAACTCGAGTTATTGCGCTTAAAGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013269.3-443s21c1
Sequence:CCGGCAACCATGGAAATGGATAAATCTCGAGATTTATCCATTTCCATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013269.3-950s21c1
Sequence:CCGGGTGCACAGGAACTCCTATTTACTCGAGTAAATAGGAGTTCCTGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013269
CLEC2D MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 2, member D
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013269.1-606s1c1
Sequence:CCGGCCAACTAATCTTTAGAAGCATCTCGAGATGCTTCTAAAGATTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013269.1-238s1c1
Sequence:CCGGCCCAGAAAGCTGGATTGGTTTCTCGAGAAACCAATCCAGCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013269.1-107s1c1
Sequence:CCGGGCTACCTTAATTTGGCGCTTACTCGAGTAAGCGCCAAATTAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013269.1-500s1c1
Sequence:CCGGTGTGCCTATTTGAATGACAAACTCGAGTTTGTCATTCAAATAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013269.3-180s21c1
Sequence:CCGGTTGCTGCTTTAAGCGCAATAACTCGAGTTATTGCGCTTAAAGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013269.3-443s21c1
Sequence:CCGGCAACCATGGAAATGGATAAATCTCGAGATTTATCCATTTCCATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013269.3-950s21c1
Sequence:CCGGGTGCACAGGAACTCCTATTTACTCGAGTAAATAGGAGTTCCTGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053109
VALIDATED
CLEC2D MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 2, member D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-428s1c1
Sequence:CCGGGCTGAATTTCCTAATGAGATACTCGAGTATCTCATTAGGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-599s1c1
Sequence:CCGGCAGGATCTATTCACTTCGGATCTCGAGATCCGAAGTGAATAGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053109.1-177s1c1
Sequence:CCGGGCTAAGCTTTACTGCTACTATCTCGAGATAGTAGCAGTAAAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-437s1c1
Sequence:CCGGCCTAATGAGATACAAGGCGAACTCGAGTTCGCCTTGTATCTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-569s1c1
Sequence:CCGGCTACCTGAACAACAACGGGATCTCGAGATCCCGTTGTTGTTCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053109
VALIDATED
CLEC2D MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 2, member D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-428s1c1
Sequence:CCGGGCTGAATTTCCTAATGAGATACTCGAGTATCTCATTAGGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-599s1c1
Sequence:CCGGCAGGATCTATTCACTTCGGATCTCGAGATCCGAAGTGAATAGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053109.1-177s1c1
Sequence:CCGGGCTAAGCTTTACTGCTACTATCTCGAGATAGTAGCAGTAAAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-437s1c1
Sequence:CCGGCCTAATGAGATACAAGGCGAACTCGAGTTCGCCTTGTATCTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-569s1c1
Sequence:CCGGCTACCTGAACAACAACGGGATCTCGAGATCCCGTTGTTGTTCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053109
VALIDATED
CLEC2D MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 2, member D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-428s1c1
Sequence:CCGGGCTGAATTTCCTAATGAGATACTCGAGTATCTCATTAGGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-599s1c1
Sequence:CCGGCAGGATCTATTCACTTCGGATCTCGAGATCCGAAGTGAATAGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053109.1-177s1c1
Sequence:CCGGGCTAAGCTTTACTGCTACTATCTCGAGATAGTAGCAGTAAAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-437s1c1
Sequence:CCGGCCTAATGAGATACAAGGCGAACTCGAGTTCGCCTTGTATCTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053109.1-569s1c1
Sequence:CCGGCTACCTGAACAACAACGGGATCTCGAGATCCCGTTGTTGTTCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks